ID: 1081483794

View in Genome Browser
Species Human (GRCh38)
Location 11:43512174-43512196
Sequence TCCCAGTACCTCCAAGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081483788_1081483794 -10 Left 1081483788 11:43512161-43512183 CCTCTCCCTCACCTCCCAGTACC No data
Right 1081483794 11:43512174-43512196 TCCCAGTACCTCCAAGGCCAGGG No data
1081483787_1081483794 -9 Left 1081483787 11:43512160-43512182 CCCTCTCCCTCACCTCCCAGTAC No data
Right 1081483794 11:43512174-43512196 TCCCAGTACCTCCAAGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081483794 Original CRISPR TCCCAGTACCTCCAAGGCCA GGG Intergenic
No off target data available for this crispr