ID: 1081483795

View in Genome Browser
Species Human (GRCh38)
Location 11:43512175-43512197
Sequence GCCCTGGCCTTGGAGGTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081483795_1081483801 5 Left 1081483795 11:43512175-43512197 CCCAGTACCTCCAAGGCCAGGGC No data
Right 1081483801 11:43512203-43512225 TCTAGCCATCGTTGAGTCCATGG No data
1081483795_1081483807 30 Left 1081483795 11:43512175-43512197 CCCAGTACCTCCAAGGCCAGGGC No data
Right 1081483807 11:43512228-43512250 CCCGGCACGGTGTTCAGTAAAGG No data
1081483795_1081483803 12 Left 1081483795 11:43512175-43512197 CCCAGTACCTCCAAGGCCAGGGC No data
Right 1081483803 11:43512210-43512232 ATCGTTGAGTCCATGGTGCCCGG No data
1081483795_1081483804 17 Left 1081483795 11:43512175-43512197 CCCAGTACCTCCAAGGCCAGGGC No data
Right 1081483804 11:43512215-43512237 TGAGTCCATGGTGCCCGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081483795 Original CRISPR GCCCTGGCCTTGGAGGTACT GGG (reversed) Intergenic