ID: 1081483797 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:43512178-43512200 |
Sequence | AGTACCTCCAAGGCCAGGGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1081483787_1081483797 | -5 | Left | 1081483787 | 11:43512160-43512182 | CCCTCTCCCTCACCTCCCAGTAC | No data | ||
Right | 1081483797 | 11:43512178-43512200 | AGTACCTCCAAGGCCAGGGCTGG | No data | ||||
1081483788_1081483797 | -6 | Left | 1081483788 | 11:43512161-43512183 | CCTCTCCCTCACCTCCCAGTACC | No data | ||
Right | 1081483797 | 11:43512178-43512200 | AGTACCTCCAAGGCCAGGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1081483797 | Original CRISPR | AGTACCTCCAAGGCCAGGGC TGG | Intergenic | ||