ID: 1081483799

View in Genome Browser
Species Human (GRCh38)
Location 11:43512185-43512207
Sequence CTAGAAGCCAGCCCTGGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081483799_1081483804 7 Left 1081483799 11:43512185-43512207 CCAAGGCCAGGGCTGGCTTCTAG No data
Right 1081483804 11:43512215-43512237 TGAGTCCATGGTGCCCGGCACGG No data
1081483799_1081483809 27 Left 1081483799 11:43512185-43512207 CCAAGGCCAGGGCTGGCTTCTAG No data
Right 1081483809 11:43512235-43512257 CGGTGTTCAGTAAAGGTTTGTGG No data
1081483799_1081483803 2 Left 1081483799 11:43512185-43512207 CCAAGGCCAGGGCTGGCTTCTAG No data
Right 1081483803 11:43512210-43512232 ATCGTTGAGTCCATGGTGCCCGG No data
1081483799_1081483807 20 Left 1081483799 11:43512185-43512207 CCAAGGCCAGGGCTGGCTTCTAG No data
Right 1081483807 11:43512228-43512250 CCCGGCACGGTGTTCAGTAAAGG No data
1081483799_1081483810 28 Left 1081483799 11:43512185-43512207 CCAAGGCCAGGGCTGGCTTCTAG No data
Right 1081483810 11:43512236-43512258 GGTGTTCAGTAAAGGTTTGTGGG No data
1081483799_1081483801 -5 Left 1081483799 11:43512185-43512207 CCAAGGCCAGGGCTGGCTTCTAG No data
Right 1081483801 11:43512203-43512225 TCTAGCCATCGTTGAGTCCATGG No data
1081483799_1081483811 29 Left 1081483799 11:43512185-43512207 CCAAGGCCAGGGCTGGCTTCTAG No data
Right 1081483811 11:43512237-43512259 GTGTTCAGTAAAGGTTTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081483799 Original CRISPR CTAGAAGCCAGCCCTGGCCT TGG (reversed) Intergenic