ID: 1081483802

View in Genome Browser
Species Human (GRCh38)
Location 11:43512208-43512230
Sequence GGGCACCATGGACTCAACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081483802_1081483811 6 Left 1081483802 11:43512208-43512230 CCATCGTTGAGTCCATGGTGCCC No data
Right 1081483811 11:43512237-43512259 GTGTTCAGTAAAGGTTTGTGGGG No data
1081483802_1081483810 5 Left 1081483802 11:43512208-43512230 CCATCGTTGAGTCCATGGTGCCC No data
Right 1081483810 11:43512236-43512258 GGTGTTCAGTAAAGGTTTGTGGG No data
1081483802_1081483812 24 Left 1081483802 11:43512208-43512230 CCATCGTTGAGTCCATGGTGCCC No data
Right 1081483812 11:43512255-43512277 TGGGGTGAGTGAATAACTGATGG No data
1081483802_1081483809 4 Left 1081483802 11:43512208-43512230 CCATCGTTGAGTCCATGGTGCCC No data
Right 1081483809 11:43512235-43512257 CGGTGTTCAGTAAAGGTTTGTGG No data
1081483802_1081483807 -3 Left 1081483802 11:43512208-43512230 CCATCGTTGAGTCCATGGTGCCC No data
Right 1081483807 11:43512228-43512250 CCCGGCACGGTGTTCAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081483802 Original CRISPR GGGCACCATGGACTCAACGA TGG (reversed) Intergenic