ID: 1081483804

View in Genome Browser
Species Human (GRCh38)
Location 11:43512215-43512237
Sequence TGAGTCCATGGTGCCCGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081483795_1081483804 17 Left 1081483795 11:43512175-43512197 CCCAGTACCTCCAAGGCCAGGGC No data
Right 1081483804 11:43512215-43512237 TGAGTCCATGGTGCCCGGCACGG No data
1081483800_1081483804 1 Left 1081483800 11:43512191-43512213 CCAGGGCTGGCTTCTAGCCATCG No data
Right 1081483804 11:43512215-43512237 TGAGTCCATGGTGCCCGGCACGG No data
1081483798_1081483804 10 Left 1081483798 11:43512182-43512204 CCTCCAAGGCCAGGGCTGGCTTC No data
Right 1081483804 11:43512215-43512237 TGAGTCCATGGTGCCCGGCACGG No data
1081483792_1081483804 20 Left 1081483792 11:43512172-43512194 CCTCCCAGTACCTCCAAGGCCAG No data
Right 1081483804 11:43512215-43512237 TGAGTCCATGGTGCCCGGCACGG No data
1081483799_1081483804 7 Left 1081483799 11:43512185-43512207 CCAAGGCCAGGGCTGGCTTCTAG No data
Right 1081483804 11:43512215-43512237 TGAGTCCATGGTGCCCGGCACGG No data
1081483790_1081483804 25 Left 1081483790 11:43512167-43512189 CCTCACCTCCCAGTACCTCCAAG No data
Right 1081483804 11:43512215-43512237 TGAGTCCATGGTGCCCGGCACGG No data
1081483796_1081483804 16 Left 1081483796 11:43512176-43512198 CCAGTACCTCCAAGGCCAGGGCT No data
Right 1081483804 11:43512215-43512237 TGAGTCCATGGTGCCCGGCACGG No data
1081483789_1081483804 26 Left 1081483789 11:43512166-43512188 CCCTCACCTCCCAGTACCTCCAA No data
Right 1081483804 11:43512215-43512237 TGAGTCCATGGTGCCCGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081483804 Original CRISPR TGAGTCCATGGTGCCCGGCA CGG Intergenic