ID: 1081483807

View in Genome Browser
Species Human (GRCh38)
Location 11:43512228-43512250
Sequence CCCGGCACGGTGTTCAGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081483798_1081483807 23 Left 1081483798 11:43512182-43512204 CCTCCAAGGCCAGGGCTGGCTTC No data
Right 1081483807 11:43512228-43512250 CCCGGCACGGTGTTCAGTAAAGG No data
1081483796_1081483807 29 Left 1081483796 11:43512176-43512198 CCAGTACCTCCAAGGCCAGGGCT No data
Right 1081483807 11:43512228-43512250 CCCGGCACGGTGTTCAGTAAAGG No data
1081483795_1081483807 30 Left 1081483795 11:43512175-43512197 CCCAGTACCTCCAAGGCCAGGGC No data
Right 1081483807 11:43512228-43512250 CCCGGCACGGTGTTCAGTAAAGG No data
1081483800_1081483807 14 Left 1081483800 11:43512191-43512213 CCAGGGCTGGCTTCTAGCCATCG No data
Right 1081483807 11:43512228-43512250 CCCGGCACGGTGTTCAGTAAAGG No data
1081483799_1081483807 20 Left 1081483799 11:43512185-43512207 CCAAGGCCAGGGCTGGCTTCTAG No data
Right 1081483807 11:43512228-43512250 CCCGGCACGGTGTTCAGTAAAGG No data
1081483802_1081483807 -3 Left 1081483802 11:43512208-43512230 CCATCGTTGAGTCCATGGTGCCC No data
Right 1081483807 11:43512228-43512250 CCCGGCACGGTGTTCAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081483807 Original CRISPR CCCGGCACGGTGTTCAGTAA AGG Intergenic