ID: 1081487102

View in Genome Browser
Species Human (GRCh38)
Location 11:43539249-43539271
Sequence CTGAGTTAGCAGCTCTGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081487102_1081487104 7 Left 1081487102 11:43539249-43539271 CCTTTGCAGAGCTGCTAACTCAG No data
Right 1081487104 11:43539279-43539301 ATCTATAAAATGGAAGTGCCAGG No data
1081487102_1081487103 -3 Left 1081487102 11:43539249-43539271 CCTTTGCAGAGCTGCTAACTCAG No data
Right 1081487103 11:43539269-43539291 CAGTTTCTGCATCTATAAAATGG 0: 10
1: 155
2: 1189
3: 4695
4: 11388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081487102 Original CRISPR CTGAGTTAGCAGCTCTGCAA AGG (reversed) Intergenic
No off target data available for this crispr