ID: 1081488075

View in Genome Browser
Species Human (GRCh38)
Location 11:43547252-43547274
Sequence GGCCCTCCATGTCAGCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081488072_1081488075 9 Left 1081488072 11:43547220-43547242 CCGTGTGGACAGTCTGTCTGCAG No data
Right 1081488075 11:43547252-43547274 GGCCCTCCATGTCAGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081488075 Original CRISPR GGCCCTCCATGTCAGCACCC AGG Intergenic
No off target data available for this crispr