ID: 1081488275

View in Genome Browser
Species Human (GRCh38)
Location 11:43547941-43547963
Sequence CGCCCCGAGAGCTCCCGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081488275_1081488292 27 Left 1081488275 11:43547941-43547963 CCCGCGCGGGAGCTCTCGGGGCG No data
Right 1081488292 11:43547991-43548013 GAGGTGATGCTGGGCGGGGCGGG No data
1081488275_1081488281 -1 Left 1081488275 11:43547941-43547963 CCCGCGCGGGAGCTCTCGGGGCG No data
Right 1081488281 11:43547963-43547985 GAGGGCGGTGCGCAGCGGTGCGG No data
1081488275_1081488283 1 Left 1081488275 11:43547941-43547963 CCCGCGCGGGAGCTCTCGGGGCG No data
Right 1081488283 11:43547965-43547987 GGGCGGTGCGCAGCGGTGCGGGG No data
1081488275_1081488290 23 Left 1081488275 11:43547941-43547963 CCCGCGCGGGAGCTCTCGGGGCG No data
Right 1081488290 11:43547987-43548009 GGCAGAGGTGATGCTGGGCGGGG No data
1081488275_1081488282 0 Left 1081488275 11:43547941-43547963 CCCGCGCGGGAGCTCTCGGGGCG No data
Right 1081488282 11:43547964-43547986 AGGGCGGTGCGCAGCGGTGCGGG No data
1081488275_1081488287 18 Left 1081488275 11:43547941-43547963 CCCGCGCGGGAGCTCTCGGGGCG No data
Right 1081488287 11:43547982-43548004 GCGGGGGCAGAGGTGATGCTGGG No data
1081488275_1081488284 2 Left 1081488275 11:43547941-43547963 CCCGCGCGGGAGCTCTCGGGGCG No data
Right 1081488284 11:43547966-43547988 GGCGGTGCGCAGCGGTGCGGGGG No data
1081488275_1081488293 28 Left 1081488275 11:43547941-43547963 CCCGCGCGGGAGCTCTCGGGGCG No data
Right 1081488293 11:43547992-43548014 AGGTGATGCTGGGCGGGGCGGGG No data
1081488275_1081488280 -6 Left 1081488275 11:43547941-43547963 CCCGCGCGGGAGCTCTCGGGGCG No data
Right 1081488280 11:43547958-43547980 GGGGCGAGGGCGGTGCGCAGCGG No data
1081488275_1081488286 17 Left 1081488275 11:43547941-43547963 CCCGCGCGGGAGCTCTCGGGGCG No data
Right 1081488286 11:43547981-43548003 TGCGGGGGCAGAGGTGATGCTGG No data
1081488275_1081488285 8 Left 1081488275 11:43547941-43547963 CCCGCGCGGGAGCTCTCGGGGCG No data
Right 1081488285 11:43547972-43547994 GCGCAGCGGTGCGGGGGCAGAGG No data
1081488275_1081488291 26 Left 1081488275 11:43547941-43547963 CCCGCGCGGGAGCTCTCGGGGCG No data
Right 1081488291 11:43547990-43548012 AGAGGTGATGCTGGGCGGGGCGG No data
1081488275_1081488288 21 Left 1081488275 11:43547941-43547963 CCCGCGCGGGAGCTCTCGGGGCG No data
Right 1081488288 11:43547985-43548007 GGGGCAGAGGTGATGCTGGGCGG No data
1081488275_1081488289 22 Left 1081488275 11:43547941-43547963 CCCGCGCGGGAGCTCTCGGGGCG No data
Right 1081488289 11:43547986-43548008 GGGCAGAGGTGATGCTGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081488275 Original CRISPR CGCCCCGAGAGCTCCCGCGC GGG (reversed) Intergenic