ID: 1081488717

View in Genome Browser
Species Human (GRCh38)
Location 11:43550416-43550438
Sequence CTGCATGAGCAAAGGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081488711_1081488717 30 Left 1081488711 11:43550363-43550385 CCAAAGAAGGGGGAAGATCTGGA No data
Right 1081488717 11:43550416-43550438 CTGCATGAGCAAAGGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081488717 Original CRISPR CTGCATGAGCAAAGGCAGAG AGG Intergenic
No off target data available for this crispr