ID: 1081495512

View in Genome Browser
Species Human (GRCh38)
Location 11:43606094-43606116
Sequence CCTAAAATATTCAAGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081495509_1081495512 -5 Left 1081495509 11:43606076-43606098 CCTCTGGTCAGGTCAATTCCTAA 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1081495512 11:43606094-43606116 CCTAAAATATTCAAGGTAGAAGG 0: 1
1: 0
2: 1
3: 20
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081495512 Original CRISPR CCTAAAATATTCAAGGTAGA AGG Intronic
905154479 1:35963705-35963727 CTTAAAATAATCCAGGTACAAGG + Intronic
905609441 1:39337383-39337405 CTTGAAATCTTCAAGGAAGATGG - Intronic
905976068 1:42174716-42174738 CCTAAAAGCTTCAAGCTGGAAGG - Intergenic
908708259 1:66984944-66984966 ACTAAAATTTTCAGGGTTGATGG + Exonic
908965096 1:69751447-69751469 CATAAAATATTTAATATAGAAGG + Intronic
910564522 1:88628377-88628399 GCTAGAATATTCAAAGTAAATGG - Intergenic
910637065 1:89420351-89420373 CATAAAATATTCAGAGAAGAGGG - Intergenic
910670189 1:89764421-89764443 AGGAAAATATTCTAGGTAGAGGG - Intronic
910803876 1:91171421-91171443 CCTAAGGTTTTGAAGGTAGAAGG + Intergenic
910999017 1:93142459-93142481 CACAAAATATCCAAGATAGAAGG - Intergenic
915094325 1:153449450-153449472 CATAAAAAATTCATGGTAGTTGG - Intergenic
915846899 1:159276252-159276274 GATAAAATCTTCAAGGAAGATGG + Intergenic
916508714 1:165452358-165452380 TACAAAATTTTCAAGGTAGAAGG + Intergenic
916788926 1:168107566-168107588 GCTAAAATATCCAAGGTTGAGGG - Intronic
918809715 1:189100273-189100295 TGTAAAATATTCTAGGTAAATGG - Intergenic
919015766 1:192033075-192033097 CCCAGAGTATTCCAGGTAGAAGG - Intergenic
919689116 1:200513150-200513172 CCTAAAATATTTAAGCTATTAGG + Intergenic
922143613 1:222916137-222916159 TCTAAAATATTTAAGGTTAAAGG + Intronic
923707942 1:236360501-236360523 CCTCAAATATTCAGGACAGAGGG + Intronic
924026878 1:239842681-239842703 CATAAAATCTCCAAGTTAGAAGG + Intronic
924137009 1:240978320-240978342 CCTAAAATACTCAACTTAAATGG + Intronic
1063465531 10:6241421-6241443 CCTAAAAAATTGAAAGTTGAAGG - Intergenic
1065572813 10:27089282-27089304 CCTGAAAAATTCAAGGCAGAGGG + Intronic
1068146506 10:53078137-53078159 CCTAAAACTTTCTATGTAGATGG + Intergenic
1068291638 10:55009434-55009456 CCTAAAATGTTGGTGGTAGATGG - Intronic
1073849281 10:107595673-107595695 CCGAAAAAATTCAAGGTGGAAGG - Intergenic
1074656388 10:115593046-115593068 CCTGAAAAGTTCAAGGTTGAGGG + Intronic
1076032195 10:127169037-127169059 CCTAGAATATTGATGCTAGATGG - Intronic
1076088166 10:127654162-127654184 CCAAGAATATTAAAGCTAGAAGG + Intergenic
1078820499 11:14875847-14875869 CATAAACTTTTAAAGGTAGAAGG - Intergenic
1079027905 11:16963305-16963327 CCTAAATTAAGCAAGGTACAAGG - Intronic
1079086203 11:17446943-17446965 CCAAACATGTGCAAGGTAGAGGG + Intronic
1079743424 11:24093838-24093860 ACAAAAATATTCCAGGTAGAGGG - Intergenic
1080054746 11:27894666-27894688 CCTAAAGTATTCATGGGTGATGG - Intergenic
1081495512 11:43606094-43606116 CCTAAAATATTCAAGGTAGAAGG + Intronic
1085950895 11:81330086-81330108 GCTAAAGTATTCAAGCCAGAGGG - Intergenic
1087917450 11:103827640-103827662 ACAATAATATTCAAGGTAGAAGG + Intergenic
1087972680 11:104504265-104504287 CCTAAAATGTACAAAGAAGACGG - Intergenic
1088096562 11:106107595-106107617 CCTAGTATATTCAAGGAACAGGG - Intergenic
1088132722 11:106513539-106513561 GATAAAATATTTAAGGAAGAAGG + Intergenic
1089652255 11:119921968-119921990 ACCAAAATATTCAAGGAAGGTGG - Intergenic
1091097523 11:132838121-132838143 CCTAAAATATTCTGGCTAAATGG + Intronic
1093240904 12:16671956-16671978 CCTAAACTATTGTAGGCAGATGG + Intergenic
1093705426 12:22269577-22269599 CCTAAAATATTCAACATTAAGGG - Intronic
1093932174 12:24965189-24965211 TCTAAATTATTCAAGAGAGAAGG - Intergenic
1094746244 12:33347417-33347439 CCAAAAGGATTCAAGGGAGAAGG - Intergenic
1095386013 12:41650929-41650951 CCCCAAATATTTTAGGTAGAGGG - Intergenic
1097417780 12:59334319-59334341 CTGAAACAATTCAAGGTAGAAGG - Intergenic
1098251212 12:68571403-68571425 CATAATATAATCAAGGCAGAGGG - Intergenic
1099889742 12:88576699-88576721 CCTAAAATATGGTTGGTAGAAGG - Intronic
1100488677 12:95056571-95056593 CTTAAAATATTTCAGGTAAAAGG - Intronic
1100635984 12:96435144-96435166 ACTAAAATATATAAGGTACAAGG + Intergenic
1102981379 12:117244105-117244127 TCTTAAATATTAAAGGAAGATGG - Intronic
1108047085 13:46393383-46393405 CCTAAAATATATAAAGTACATGG - Intronic
1108638448 13:52359492-52359514 TCTAAAATATTAAAGGAATAGGG - Intergenic
1109700542 13:66019172-66019194 GCTAAAATCTTCAAGGAATAAGG - Intergenic
1110108509 13:71711383-71711405 CCTCAACTATTCAAGATAAATGG - Intronic
1110454317 13:75673106-75673128 CTTAAATTATTCCAGATAGATGG - Intronic
1111551245 13:89816338-89816360 CCTAGAATATGCAAGTTTGAGGG - Intergenic
1111778369 13:92691741-92691763 CCTAAAATTTTCTATATAGATGG + Intronic
1112511542 13:100013751-100013773 CCTTAATTATTCTAGTTAGAGGG - Intergenic
1115933451 14:38524911-38524933 CCTAAGATTTTCAAGGTTGGAGG + Intergenic
1117793453 14:59365625-59365647 TTGAAAATATTTAAGGTAGATGG + Intronic
1117937351 14:60921063-60921085 GCTAGAAAATTCATGGTAGAAGG - Intronic
1118519465 14:66565649-66565671 ACTAAAATAATCAATGTAAAAGG + Intronic
1118668776 14:68100178-68100200 CCTCAACTATAGAAGGTAGAAGG + Intronic
1120212547 14:81647941-81647963 CAGAAATTATTCAAGCTAGAGGG + Intergenic
1120859794 14:89244802-89244824 GATAAAATGTTCAAGCTAGAGGG + Intronic
1124855163 15:33380532-33380554 TCTAGAATTTTCAAGGGAGAGGG + Intronic
1124972878 15:34506915-34506937 CCTAAAATTTTCTATATAGATGG + Intergenic
1126440172 15:48679144-48679166 CCTATGATATCCAAGGTAAAGGG + Intergenic
1127470877 15:59289010-59289032 CCTAAAATATTGTAGCTGGAAGG + Intronic
1129817523 15:78567776-78567798 CTTATAATTTTCAAGGTGGAAGG - Intronic
1131497998 15:92931756-92931778 CCTTACATATTTAAGGTAAAGGG - Intronic
1132187519 15:99814721-99814743 CCTAAAATTTTCTATATAGATGG - Intergenic
1133779475 16:8926482-8926504 CCAAAAAAATTCAAGATAGGAGG + Intronic
1133828371 16:9299104-9299126 CCTAAAATATTGAGGTTTGAAGG + Intergenic
1135213661 16:20545428-20545450 CCTAAACTATTCCAGGCAGGTGG - Intronic
1139870525 16:70104901-70104923 CCTAAATTATTGAAGGTAAAAGG + Intergenic
1140384921 16:74527644-74527666 CCTAAATTCTTGAAGGTAAAAGG - Intronic
1140672697 16:77294450-77294472 CATAAAATTTTAAAGTTAGAAGG - Intronic
1140855039 16:78970574-78970596 AGTAAGACATTCAAGGTAGAAGG + Intronic
1143100992 17:4504652-4504674 CCTGAAATCTTGAAGGTAGAAGG + Intronic
1143149918 17:4801455-4801477 CCTAAAAGATTGGAGGAAGAAGG + Intergenic
1144114289 17:12071493-12071515 ACTAAAATATTCACTGGAGACGG + Intronic
1145947779 17:28790769-28790791 ACTAAAGTATTCAAGGATGATGG + Intronic
1149014283 17:51889994-51890016 CCTAAGATAATCAATGTAAAGGG - Intronic
1150956022 17:69861512-69861534 GCTTAAATATTCAAGGAAAATGG + Intergenic
1151490225 17:74428411-74428433 CATAAAATGTTCGAGGTGGAAGG + Intronic
1152981906 18:286141-286163 CCTAGAAAATTCAGGGTGGAAGG - Intergenic
1153264100 18:3251488-3251510 CCTAAAATATTAAAGCGATATGG + Intronic
1153443162 18:5143429-5143451 TCTAAAAAATTCAAGGTAAGTGG - Intergenic
1155689250 18:28597639-28597661 CCTAAAATATTCATTCTAGAAGG + Intergenic
1155951402 18:31917303-31917325 CATGAAATATTCAAGCTAGGGGG + Intronic
1158096683 18:53780129-53780151 CCTAAAAAATTCTAGAAAGATGG - Intergenic
1158124510 18:54086654-54086676 CCTAATATACTCATGGTGGAAGG + Intergenic
1158688417 18:59636736-59636758 CATAAAAGATCCAAGATAGAAGG + Intronic
1158762857 18:60411108-60411130 CCTGGAATATTGAAGGGAGAAGG + Intergenic
1159755390 18:72358037-72358059 CCTATGATATTGAAGGTAGTTGG - Intergenic
1159991102 18:74908848-74908870 CAAAAAATGTTCAAAGTAGAGGG - Intronic
925367957 2:3324101-3324123 TCTAAAGTAGTCAAGGCAGACGG + Intronic
930846426 2:55909888-55909910 CTTAATAGAGTCAAGGTAGAAGG - Intronic
932670144 2:73730163-73730185 ATTAAAATATTCAAAGTAGAGGG + Intronic
932839968 2:75072820-75072842 CCTCAAATCTTCAAGGTCTATGG + Intronic
932933403 2:76070166-76070188 CCCAAAAAAATCAAAGTAGAGGG - Intergenic
933046825 2:77548997-77549019 CCTAAAATATTGACATTAGAAGG + Intronic
933978851 2:87534185-87534207 CGGAAAATATGCAAGGCAGATGG - Intergenic
935432303 2:102989284-102989306 CTTGAAATATTCAAGTAAGAAGG - Intergenic
935929854 2:108112838-108112860 CCTCAAAGATTGAAGGTAGATGG - Intergenic
937561419 2:123229409-123229431 CATATAATATTTAAGGTAAAGGG - Intergenic
938564381 2:132505106-132505128 GCTGAGAAATTCAAGGTAGAGGG + Intronic
940631696 2:156248203-156248225 CAAAAGATATTCAAAGTAGAGGG + Intergenic
941399502 2:165013355-165013377 CCCAAAATATTCAGGGCAGTGGG + Intergenic
943386231 2:187206588-187206610 CTTAAAATATTCAAAGCAGGTGG + Intergenic
944402432 2:199343631-199343653 CCCAACCTAATCAAGGTAGATGG - Intronic
944563559 2:200964915-200964937 GGTAAAATTTTCCAGGTAGAAGG + Intergenic
946899231 2:224356194-224356216 CCTAAAATATGGAAGGTACCTGG - Intergenic
1169557969 20:6769093-6769115 CCAAAAGTATTCCAGGGAGAGGG - Intronic
1170083764 20:12506300-12506322 CATCAAATTTTCAAAGTAGAGGG + Intergenic
1170307467 20:14955506-14955528 CATGATATATCCAAGGTAGAAGG + Intronic
1170396210 20:15928161-15928183 ACTAAAGTATTCAAGGCTGATGG + Intronic
1176123690 20:63465658-63465680 CCTAACAGATGCAAGGTCGAAGG - Intronic
1179062765 21:37994993-37995015 CCTAAAACTTCCAAGGCAGATGG - Intronic
1181775530 22:25157683-25157705 CCCAAAATAATCAGGGGAGAGGG - Intronic
1182319359 22:29468386-29468408 CATAAAATATTCAAGCCAGAAGG + Intergenic
949754818 3:7396981-7397003 CCTTGAACATTCAAGGAAGATGG + Intronic
950682181 3:14592981-14593003 CAGAAAATACTCAAGTTAGATGG - Intergenic
951356385 3:21672018-21672040 TCTCAAATATTCAAGGTTGTTGG + Intronic
951371416 3:21854392-21854414 CCAAAAATATTCTATGCAGATGG + Intronic
955180485 3:56664224-56664246 CATGGAATATTCAAGGTACAAGG + Intronic
955557870 3:60157449-60157471 CATAGAATATTCAAACTAGAAGG - Intronic
956611486 3:71128010-71128032 CCTTATATAGTCAAGGAAGAGGG + Intronic
957463200 3:80550154-80550176 CCAAAAATATTCTAGATATATGG + Intergenic
958020282 3:87986220-87986242 TCTAAATTAATAAAGGTAGATGG + Intergenic
958061851 3:88493972-88493994 CTTAAAATTTGCAAGGAAGATGG - Intergenic
958539033 3:95446164-95446186 CTTAAAATATTGATTGTAGAAGG - Intergenic
959345446 3:105189007-105189029 CCTGAAATGTTTAAGGGAGATGG - Intergenic
959944640 3:112113952-112113974 CATAAAATATTCAAGATTGTTGG - Intronic
960600253 3:119450068-119450090 CCTAAAATATCTAAATTAGATGG - Intronic
961993968 3:131221234-131221256 CTTCTAATATTCCAGGTAGATGG - Intronic
962883587 3:139601857-139601879 CCTACAATGTTGAAGGCAGATGG + Intronic
963092541 3:141498078-141498100 TATAAAATATTCTTGGTAGATGG + Intronic
963459402 3:145589197-145589219 TTTAAAAAATTCAAGGTAAAGGG + Intergenic
964177099 3:153837253-153837275 GCTAAAATATTAAAGTTAGTGGG - Intergenic
965207980 3:165746196-165746218 ATTAAAATATTCAAGGTAGATGG - Intergenic
966112596 3:176420529-176420551 CTTAAAATATTTTAGGTATAAGG + Intergenic
966829956 3:183999389-183999411 CTTAATATATTCAAGCTATAAGG + Intronic
971296591 4:25399150-25399172 ACTAAAGTATTCCAGGTAAAAGG - Intronic
972942016 4:44207480-44207502 CCTATAATATGTAAGGTAGGTGG - Intronic
974720777 4:65735903-65735925 CCTAAAAACTTCAAGGAAGCTGG + Intergenic
975233141 4:71958241-71958263 CTTTAAATATTCAAGGAAAACGG - Intergenic
976033510 4:80787705-80787727 CCTAAAATATTTAAGGCATATGG + Intronic
978838661 4:113183862-113183884 GCTAAAATCTTCAAGGGACAAGG + Intronic
980858783 4:138473730-138473752 TCTGAAATATTCAAAGTAAATGG + Intergenic
981689545 4:147492019-147492041 GAAAAAATATTCCAGGTAGAAGG - Intronic
982063130 4:151624672-151624694 CCTAAAATATTTGAGGAAGGAGG - Intronic
988224841 5:28399813-28399835 CCTAAGATTTTAAAGGTATAAGG + Intergenic
988846447 5:35132680-35132702 CCTAAATTTCTCAAGGCAGAAGG + Intronic
989995426 5:50823670-50823692 CCAAAAATAATCAAGGTCTAGGG - Intronic
990085814 5:51975250-51975272 CCTAAAAAATTCAAGCAAGAAGG + Intergenic
991336384 5:65552453-65552475 CCTAAAAAATACAAGGTAAGTGG - Intronic
991445299 5:66693751-66693773 CCTAGAATTTTTAAGCTAGATGG + Intronic
992367829 5:76111480-76111502 CTGAAAATATTCAGGGTGGAGGG - Intronic
992965692 5:81997397-81997419 CCTAAAATCTTCCAGATTGAAGG + Intronic
993520438 5:88892814-88892836 CCTAAAGAATTCAAGCTAGGGGG - Intronic
995070653 5:107918037-107918059 CCAAAAATGTGGAAGGTAGAAGG - Intronic
996694762 5:126382023-126382045 CATAAAACCTACAAGGTAGAAGG - Intronic
997017357 5:129952065-129952087 CCATAAATATTCAAGGCAGGAGG + Intronic
1001307533 5:170586299-170586321 CCTAATATATGCAAGGTACTGGG - Intronic
1001398116 5:171431117-171431139 GCTAAAATCTTCAAGCCAGAGGG + Intronic
1003489706 6:6610637-6610659 CCTAAAATGGTCAAGCTAGAAGG + Intronic
1003975584 6:11340675-11340697 TCTGAATTATTCAAGGTCGATGG - Intronic
1004451919 6:15755271-15755293 TCCAGAATATTCAAGGAAGATGG + Intergenic
1010096591 6:72053533-72053555 CCAAAAACACTCTAGGTAGATGG - Intronic
1010124649 6:72418112-72418134 CCTAAAATGTTAAAGCTGGAAGG + Intergenic
1011215289 6:84999199-84999221 TTTACAATATTCAAGTTAGAAGG + Intergenic
1013838939 6:114366952-114366974 TCTAAAATGTTTAAGCTAGAAGG - Intergenic
1015236316 6:130975305-130975327 TTTAAAATATTCAAGGAAGTTGG + Intronic
1015294494 6:131575199-131575221 TCTAAAATATGAAAGGGAGAAGG + Intronic
1016081071 6:139856917-139856939 TTTAAAATATTGAAAGTAGATGG + Intergenic
1016731436 6:147432198-147432220 CCTAAAAGTTTCAGGGTTGAGGG - Intergenic
1017399370 6:154041491-154041513 CATAAACTAATCAAGCTAGAAGG + Intronic
1021165268 7:17331487-17331509 CCTAAAATAGTCAAAATACAAGG - Intronic
1021642931 7:22757753-22757775 TTTAAAATATGCAAAGTAGAGGG + Intergenic
1021741640 7:23692168-23692190 TCTAAACTATTAAAGGTAGATGG + Intronic
1022202393 7:28129174-28129196 TCTAAAATATGAGAGGTAGAGGG - Intronic
1023087072 7:36581475-36581497 AATAAAATACTCAAGGCAGAGGG - Intronic
1027816956 7:82987062-82987084 CCTAAATGAATCATGGTAGATGG + Intronic
1027890085 7:83962073-83962095 TTTAAAATATTCAAGGTAACTGG + Intronic
1030455700 7:109771639-109771661 TCAAATATATTCCAGGTAGATGG - Intergenic
1030869660 7:114739711-114739733 CCAAAAACATTCTAGGAAGAAGG - Intergenic
1031212140 7:118843329-118843351 CCTAAAATATTTAATCTAAAAGG - Intergenic
1034648486 7:152670131-152670153 CTAAAGATATTCCAGGTAGAAGG - Intronic
1034850583 7:154489687-154489709 CCCAAAATATTCAGAGAAGAGGG - Intronic
1036197104 8:6728460-6728482 ACTAAAATATTCAAGTTTAAGGG + Intronic
1037092728 8:14943293-14943315 TGTTAAATATTTAAGGTAGAAGG - Intronic
1037897241 8:22666150-22666172 CCTAAAATCATCAAGGTGTATGG + Intronic
1039104949 8:33980210-33980232 CCTAGGAGATTCAAGGGAGAGGG + Intergenic
1039468465 8:37799500-37799522 CCTAACATATCAAAGGCAGAAGG + Intronic
1042785457 8:72540975-72540997 CCTAAAATATTCTTGGGAGCAGG - Intronic
1043150632 8:76711024-76711046 CCTTTTATATTTAAGGTAGAAGG + Intronic
1043613775 8:82099646-82099668 AATAAAATATGCAAGGAAGATGG + Intergenic
1043644808 8:82503943-82503965 CCTAAAATATTCTAAGTATTTGG - Intergenic
1044681278 8:94780337-94780359 CCTAAAATATTAAAGCAAAAAGG - Exonic
1045988325 8:108276338-108276360 CTTGAAATTTTCAAGGTACAGGG - Intronic
1047048489 8:121082060-121082082 CATAAAAAATTAAAGCTAGATGG - Intergenic
1047080177 8:121451727-121451749 CCTTGAACATTCAAGGAAGAAGG - Intergenic
1048656165 8:136538991-136539013 CATAAAATATTAAAAATAGATGG + Intergenic
1050391172 9:5146191-5146213 CCTAAAATCTTCAAGAAACAAGG - Intronic
1052139569 9:24962723-24962745 CGTAAAATATTAAAGAAAGAAGG + Intergenic
1053002828 9:34586613-34586635 CCAAAACTATTCAAGGGGGATGG + Intronic
1053151741 9:35748206-35748228 CCTAAAATATGCCAGGGATAGGG + Intronic
1055528644 9:77160605-77160627 CCTAAAAATGTCAAGGAAGATGG + Intergenic
1056785421 9:89589320-89589342 CTTAAATTCTTAAAGGTAGAAGG - Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1058249451 9:102673191-102673213 CTTAACAGAATCAAGGTAGAAGG + Intergenic
1058605725 9:106720511-106720533 GCAAAAATATTTAAGGTAGAAGG - Intergenic
1058732790 9:107866567-107866589 CCAAAAGTATTAAATGTAGAAGG + Intergenic
1059772676 9:117442539-117442561 GAGAAAATATTCAAGGCAGATGG - Intergenic
1186045264 X:5529738-5529760 CTGAAAATAATCATGGTAGAAGG - Intergenic
1188383047 X:29521265-29521287 CCTGAAATTTTCAATGTCGATGG + Intronic
1188728328 X:33612638-33612660 GATAAAATATTCCAGGTAAATGG - Intergenic
1188844668 X:35058476-35058498 CCTGAGATATTTAAGGTAGATGG - Intergenic
1188994761 X:36870309-36870331 CCTAAAATATTTATGGCAAATGG - Intergenic
1190491965 X:50991291-50991313 CCTAAAATATTACAGGTAAAAGG + Intergenic
1190501197 X:51080389-51080411 CCTAAAATATTACAGGTAAAAGG - Intergenic
1190982671 X:55470273-55470295 CCTAAAATATACATAGAAGAGGG - Intergenic
1190986028 X:55502910-55502932 CCTAAAATATACATAGAAGAGGG + Intergenic
1191067377 X:56364353-56364375 CTTAAGATTTTCAAGGTAAACGG + Intergenic
1192800170 X:74458096-74458118 CCTCAAATAATCAGGCTAGAAGG + Intronic
1192847008 X:74916641-74916663 GCTGAAAAGTTCAAGGTAGAGGG - Intronic
1194605938 X:95977604-95977626 TCAATAATATTCAAGGTAAATGG + Intergenic
1194686276 X:96921625-96921647 AGTAAAATTTTCAAGGAAGAAGG - Intronic
1197408049 X:126078587-126078609 CCTAGAATCTCCAGGGTAGAAGG + Intergenic
1198131332 X:133698222-133698244 CCAAAAATATGAAAGCTAGAAGG + Intronic
1198181366 X:134212693-134212715 CCTTAAATATTCAAGATACAAGG - Intergenic
1198716495 X:139563373-139563395 TCTAGAAGATTCAAGATAGAAGG - Exonic
1199751933 X:150828007-150828029 CCTACAATAATCAAGATAGTGGG - Intronic