ID: 1081496050

View in Genome Browser
Species Human (GRCh38)
Location 11:43611559-43611581
Sequence CTGGAAGTCTGCAGTTATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081496050 Original CRISPR CTGGAAGTCTGCAGTTATGA AGG (reversed) Intronic
901880071 1:12188674-12188696 CTGCCAGTCTGCACTGATGATGG - Intronic
902684200 1:18065180-18065202 CTGCAAGTCTGCAGCTTGGAAGG + Intergenic
904011926 1:27394814-27394836 CTGGAATTCTGTAGTAATCAGGG - Exonic
904074589 1:27830618-27830640 CTGGAAGTCTCCAGTGGTTAGGG - Intergenic
905093751 1:35451055-35451077 CTGGAGGTCTGCATATCTGATGG + Intronic
905360064 1:37412980-37413002 CTGGAAGTTTGCACTGATTATGG + Intergenic
910485655 1:87710736-87710758 CTGGAAGTCTACAAATATCAAGG + Intergenic
913328259 1:117646518-117646540 CTGGAAGCCAGCAGCTCTGAGGG + Intergenic
915298801 1:154940471-154940493 CTGGCAGCCTGCAGGTCTGAGGG - Intergenic
919429140 1:197471322-197471344 CTGTAAGACTGCAGTTAGCAGGG - Intronic
920641549 1:207756333-207756355 GTGAAAGTCTGAATTTATGATGG - Intronic
923327922 1:232897250-232897272 CTAGAAATCTGGAGTTATCAGGG - Intergenic
924144850 1:241063424-241063446 GTGGAAGCCTGCACTTCTGACGG - Intronic
924373677 1:243383831-243383853 CTGGAAATCAGCAGGTAAGAGGG - Intronic
924955678 1:248924273-248924295 CTGGAAGCCAGCAGTCATGAAGG - Intergenic
1065199666 10:23300878-23300900 CTCTCAGGCTGCAGTTATGACGG + Intronic
1068705756 10:60073649-60073671 CTGGAAGACTCCAGATAAGAAGG + Exonic
1071398937 10:85250542-85250564 CTGGAAGGATGCTGTCATGAAGG + Intergenic
1071689797 10:87804999-87805021 CTGGAAGTATACCGTTATGTTGG - Intronic
1071870077 10:89784381-89784403 CTGGAAGTCATTAGTTATCAGGG + Intergenic
1073522351 10:104144800-104144822 CTGGAAATCTGCATTTATAATGG + Intronic
1077905218 11:6527501-6527523 TTGGAAGACTGCAGTTTTGGCGG + Intronic
1078300277 11:10122793-10122815 GTGTAAGTGTGCAGGTATGAAGG - Intronic
1078762749 11:14264383-14264405 CTGGAACTCTGAAGTTAAGCTGG - Intronic
1079422307 11:20305014-20305036 CAGAAAGTCTGCAGTCAGGATGG + Intergenic
1080149617 11:29035472-29035494 ATTGAAGTCTGCAGTTGTGGTGG + Intergenic
1081496050 11:43611559-43611581 CTGGAAGTCTGCAGTTATGAAGG - Intronic
1081685458 11:45039672-45039694 CTGGAATTCTGGACTTCTGATGG + Intergenic
1085354214 11:75821020-75821042 CTGGAAATATACAGTGATGATGG - Intronic
1086810186 11:91300396-91300418 CTGGAGGTCTGCTGTTCTGAAGG + Intergenic
1087843621 11:102946245-102946267 CTTGAAATATGCAGTTATGGAGG - Intronic
1088409102 11:109513774-109513796 CTGGAAGGGAGCAGTTAGGAAGG + Intergenic
1089780399 11:120869686-120869708 CTGCAAATCTGCCGTGATGACGG + Intronic
1091342184 11:134824469-134824491 CTGGGAGACTGCAGAGATGAAGG + Intergenic
1096276924 12:50217433-50217455 TTTGAAGTCTCCAATTATGAGGG - Intronic
1096416403 12:51417997-51418019 CTGGCAGTCTGGAATTATAAGGG + Intronic
1099232954 12:80049222-80049244 CTTGAAGTATGCAGCTATGCTGG - Intergenic
1101038248 12:100726603-100726625 CTGGAATTCTGCATTTCTAATGG + Intronic
1102487669 12:113269094-113269116 CTGGAAGGCTGCGGATAAGATGG - Intronic
1104879773 12:132062493-132062515 CTGGAAATGTGCAGGTGTGATGG - Exonic
1109683337 13:65782552-65782574 ATGGAAGTCAGCTGTTATGGGGG - Intergenic
1113988529 13:114339353-114339375 CTGGAAGCCAGCAGTCATGCAGG - Intergenic
1114072402 14:19124271-19124293 TTTGAAGTCTGCAGATATTATGG + Intergenic
1114089857 14:19275702-19275724 TTTGAAGTCTGCAGATATTATGG - Intergenic
1116059755 14:39908079-39908101 TTGGAAGTCTGAAGGCATGATGG + Intergenic
1116290284 14:43026444-43026466 CAGGAAGCCTACAATTATGATGG - Intergenic
1117408447 14:55427744-55427766 CGGGAAGTCTGAAGTCAGGAAGG + Intronic
1118099925 14:62586477-62586499 TTGGAAGTTTGCAGTTATCAAGG + Intergenic
1121169707 14:91843326-91843348 CTGGAACTCTGGGGTCATGATGG - Intronic
1121178190 14:91906684-91906706 CTGGATGTCTCCAGTGAGGAAGG + Intronic
1121615565 14:95311421-95311443 CGGGAGGTCTGCAGTTCTGCAGG + Intronic
1123937265 15:25200004-25200026 CTGGAGCCCTGCAGTGATGACGG + Intergenic
1126672143 15:51126224-51126246 CTGGAAGCCTCCTGTTAGGATGG + Intergenic
1131862725 15:96671457-96671479 CTGGATGTCCTCATTTATGAAGG - Intergenic
1140610726 16:76595873-76595895 GTAGAAGTTTGCAGTTATGTAGG + Intronic
1140757773 16:78083952-78083974 CTGCAAGTCTGCATTTTTGGGGG - Intergenic
1141639123 16:85330877-85330899 CTGGAAGTCTGCTGCTGTGTGGG + Intergenic
1145966088 17:28918555-28918577 TTGGAAGGCTGCTCTTATGAGGG + Intronic
1147198726 17:38785139-38785161 CTGGGAGTCTGTATTGATGAGGG - Intronic
1148997531 17:51724054-51724076 CTGGAAGTTTGGAATTTTGAGGG + Intronic
1149548340 17:57521134-57521156 CTGGAAGACTGCAGTGATGAAGG - Intronic
1153355558 18:4131107-4131129 CTGAATGTCTGCAGTTATCTTGG - Intronic
1158912651 18:62081179-62081201 TTGGAAGCCTACAGTTAAGATGG - Intronic
1160894497 19:1396273-1396295 CTGGGGATCGGCAGTTATGACGG + Intergenic
1165442169 19:35835257-35835279 CTGCAAGTCTGCAATTCTGCAGG + Intronic
1166493341 19:43278884-43278906 CAGGAAGACTGCAGGTATGATGG - Intergenic
1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG + Exonic
1167572923 19:50301207-50301229 CTGGGAATCTGCACTTATAACGG - Intronic
1168578350 19:57532825-57532847 GTGGAAGACTTCAATTATGATGG + Intronic
924959327 2:19719-19741 CTGGAAGCCAGCAGTCATGCAGG + Intergenic
926476703 2:13330967-13330989 CTGGAAATGTGTAGTCATGATGG + Intergenic
927199448 2:20569260-20569282 GTGGAAGTCTGCGATTTTGAAGG - Intronic
928772724 2:34720938-34720960 CTGGAATTTTGCAGTGAGGAAGG + Intergenic
930144463 2:47987234-47987256 TCGAAAGTCTCCAGTTATGATGG - Intergenic
934154174 2:89179842-89179864 CAGGAAGCTTACAGTTATGATGG - Intergenic
934213059 2:90002093-90002115 CAGGAAGCTTACAGTTATGATGG + Intergenic
936387362 2:112042145-112042167 CTCTAGGGCTGCAGTTATGATGG + Intergenic
936514728 2:113174363-113174385 CTGGAGGTCTGCAATAGTGAAGG + Intronic
938169895 2:129066010-129066032 CTGGAAGTTTGTAGTGAAGAAGG - Intergenic
938486639 2:131717754-131717776 TTTGAAGTCTGCAGATATTATGG + Intergenic
939218690 2:139274125-139274147 ATGGAACTCTGCAGCTAGGAAGG + Intergenic
940372390 2:152917920-152917942 CTGGAACTCTGGACCTATGATGG - Intergenic
941393646 2:164947539-164947561 GTAGAAGTCTGAAGTTTTGAAGG - Intronic
942200551 2:173566621-173566643 CTGGAAGACTGCATTGATTAGGG - Intergenic
946510240 2:220348251-220348273 CTGTAATTATGCAGATATGAAGG + Intergenic
948758045 2:240170418-240170440 CTGGAACTCTGCACTGAGGAAGG - Intergenic
948966915 2:241389450-241389472 CTGGAAGTCTGCAGTCAAGCTGG - Intronic
1172228793 20:33323255-33323277 CTGGCAGACTGCAGTCAGGAGGG - Intergenic
1173154949 20:40600907-40600929 CTCTGAGTCTGCTGTTATGAAGG + Intergenic
1173769988 20:45647946-45647968 CTTGAAGCCTGAAGCTATGAGGG + Intergenic
1174062453 20:47842570-47842592 GAGGAAGTCTGCAGTGAAGACGG + Intergenic
1177438555 21:21087805-21087827 CTGGAAGGCTGAAATAATGAAGG + Intronic
1177887805 21:26766713-26766735 CAGTAAGTTTGTAGTTATGAAGG - Intergenic
1178083753 21:29092602-29092624 CTGGAAGTCTCAGGTTCTGAAGG + Intronic
1179146550 21:38773467-38773489 CTGGAAGACGGCAGTCCTGAGGG - Intergenic
1179813819 21:43890296-43890318 CTGGAAGTCTACCATCATGACGG - Intronic
1180140481 21:45890497-45890519 CTGGAACTCTGCACTGCTGAGGG + Intronic
1180140534 21:45890962-45890984 CTGGAACTCTGCACTGCTGAGGG + Intronic
1180490847 22:15846645-15846667 TTTGAAGTCTGCAGATATTATGG + Intergenic
1183489141 22:38107525-38107547 CTGGGAGGCTGCAGTGAGGAGGG + Intronic
1184608636 22:45588588-45588610 CTGGAAGTCAGCAGGTGTGTGGG - Intronic
949324149 3:2844618-2844640 GTGGAATTTTGCAGGTATGATGG - Intronic
949575931 3:5339256-5339278 CTGCGAGGCTGCAGTTCTGATGG - Intergenic
949652964 3:6182175-6182197 CTTGAAATCTGCACTTATCATGG - Intergenic
950334000 3:12179315-12179337 CTGGAACTCTGTAGCTAAGAAGG + Intronic
951525545 3:23649439-23649461 CAGGAAGAGTGCAGTTAAGAAGG + Intergenic
953213304 3:40895358-40895380 CTGAAAGCCTGCAGTTTAGAAGG - Intergenic
956074792 3:65493511-65493533 CTGGAAGTCGGCACCTATGAAGG - Exonic
957828048 3:85475770-85475792 ATGGAAATCTACATTTATGAAGG + Intronic
959705292 3:109333660-109333682 GTGGAAGTCTGAAGATAGGAAGG + Intronic
960366282 3:116776835-116776857 ATGCTAGTCTGCAGTTCTGATGG - Intronic
961983613 3:131107644-131107666 ATGGAAATCTGCATATATGAAGG - Intronic
965673259 3:171168911-171168933 CTTCAAGTCTGCACTTTTGAGGG + Intronic
966980699 3:185132017-185132039 CTGGAAGTCTGAAGTTTGGCTGG - Intronic
968374738 4:29900-29922 CTGGAAGCCAGCAGTCATGCAGG + Intergenic
969672205 4:8596004-8596026 CTGGAAGTCTGCAGGTCTGCAGG - Intronic
970453085 4:16191293-16191315 CTTCAAGTCTTCAGTTCTGAAGG - Intronic
974372248 4:61032602-61032624 CTGAAAGTCTGCAGTGCTGAGGG - Intergenic
977665519 4:99643074-99643096 CTGGGAGTCTGCATTGATAAGGG + Intronic
977706412 4:100075772-100075794 CTGGAAGTCTGCAATGAGAAAGG - Intergenic
978635170 4:110795689-110795711 CTTGAAGTCGTCAGTGATGATGG + Intergenic
980061022 4:128129630-128129652 CTGTAAAGCTGCAGTAATGAAGG + Intronic
980816873 4:137959155-137959177 TAGAAAGTCTGCAGGTATGATGG - Intergenic
981652627 4:147076803-147076825 CTGGAAGACAGCAGTGATGAGGG - Intergenic
981912966 4:150003364-150003386 TTGGAAGTCTGCAGTCAGGCTGG - Intergenic
984116780 4:175691348-175691370 CTGAAAGTCTACATTTAGGAAGG - Intronic
984723698 4:183000376-183000398 CTGTCAGGCTGCAGTTATGGTGG - Intergenic
985085413 4:186308119-186308141 CTGGAACACTGCAGTACTGAAGG - Intergenic
986154679 5:5162931-5162953 CTGGAATTCTGCATTTATTGTGG + Intronic
986990376 5:13545711-13545733 GTGGCAGTCTGCAGTGGTGATGG - Intergenic
988573901 5:32400545-32400567 CTGGAAGTTAGCAGTTTTTAAGG - Intronic
990057212 5:51598108-51598130 ATGACAGGCTGCAGTTATGATGG + Intergenic
993581416 5:89666252-89666274 CTGAGACTCTGCAGTTCTGATGG + Intergenic
994961995 5:106617041-106617063 CTGGAGGTATACAGATATGATGG - Intergenic
995554933 5:113317905-113317927 CTGTAAGACTGTAATTATGACGG - Intronic
996555464 5:124774196-124774218 CTGAAAGCCTGTAGTTATGGTGG - Intergenic
997450802 5:133981543-133981565 CTGGAACTCTGCAGTCATGGGGG + Intronic
999258253 5:150222007-150222029 CTGGAATTCTCCAGGGATGACGG + Intronic
999891826 5:155986348-155986370 CTGGAAGACTGCAGTCATAAAGG - Intronic
1001039913 5:168326906-168326928 CTGCAAATCTGCATTTTTGAAGG + Intronic
1002755723 6:157962-157984 CTGGAAGCCAGCAGTCATGCAGG + Intergenic
1003381377 6:5627541-5627563 TTGAAATTCTGCAGTGATGATGG + Intronic
1009431544 6:63572219-63572241 CAGGAAGCCTGAAGTTAAGAAGG - Exonic
1011628047 6:89299257-89299279 CTGGGAGTTTGCTGTTTTGATGG - Intronic
1011884304 6:92075100-92075122 CTACAAGTATGCAGTTATCATGG - Intergenic
1011897274 6:92244626-92244648 CTGGAATTATGCGGTTGTGAAGG + Intergenic
1014503705 6:122226740-122226762 CTGGAAGTCTACTGCTCTGAGGG + Intergenic
1016421728 6:143892192-143892214 CAGGAAGTCTCCAATCATGATGG + Intronic
1017339657 6:153305539-153305561 CAGGAAGTTTGTAGTTATGGTGG - Intergenic
1019533124 7:1513534-1513556 CCGTGAGTCAGCAGTTATGAGGG + Intergenic
1023030326 7:36085124-36085146 CTGAAATTCTGCATTTCTGAGGG + Exonic
1025231990 7:57208568-57208590 GAGGAAGTCTGCAGTGAAGATGG - Intergenic
1026979450 7:74517992-74518014 CACAAAGTCTGCAGTTATGAGGG + Intronic
1030777598 7:113553653-113553675 CAGGAAGTTTGCAGTCATGGTGG + Intergenic
1033502695 7:141967691-141967713 CAGGAAGTTTACAGTCATGATGG - Intronic
1034555822 7:151849770-151849792 TTGGGAGGCTGCAGTTATGCTGG + Intronic
1035929586 8:3765703-3765725 CTGCAAGGCTGCAGTGCTGATGG - Intronic
1035951560 8:4027559-4027581 CAGGAACCATGCAGTTATGATGG - Intronic
1039766520 8:40633974-40633996 TGGGAAGTCAGCAGTGATGAAGG + Intronic
1042370363 8:67984661-67984683 CTGGAAGACTGCAGGTCTGCCGG + Intronic
1049229839 8:141476214-141476236 CCTGAAGTCTGCAGGGATGAAGG - Intergenic
1050134859 9:2451924-2451946 TTGGAAGTCTTCAGTTTTGATGG + Intergenic
1050593768 9:7185689-7185711 GTGGAAGTTTCCAGTTCTGATGG + Intergenic
1052943844 9:34151499-34151521 CTGGATGTCTGCAGATAAGGAGG - Intergenic
1055123245 9:72687436-72687458 CTGAAAGTTTGCAATAATGAAGG - Intronic
1055179405 9:73365446-73365468 CTGGAATTAGACAGTTATGATGG - Intergenic
1056000360 9:82210093-82210115 GTGGATGTCTGCAGTGGTGATGG + Intergenic
1056541380 9:87574461-87574483 CAGGAAGTTTGCAGTCATGCTGG + Intronic
1058983128 9:110188457-110188479 CTGGACGTCTGCAGTGAGGAAGG - Intergenic
1060236683 9:121868589-121868611 GTGGAAGTATGCACTTAGGAGGG + Intronic
1203408079 Un_KI270538v1:66310-66332 CTGCAAGTCTGCAGTGAGGCTGG + Intergenic
1203574482 Un_KI270744v1:164251-164273 CTGGAAGCCAGCAGTCATGCAGG - Intergenic
1187979490 X:24740213-24740235 CTGGAAGTTTCCAGTGATAATGG - Intronic
1192217104 X:69167564-69167586 CAGGAAGTCTGCAATTATAGTGG + Intergenic
1195605072 X:106797166-106797188 CAGGAAGTTTACAGTCATGATGG + Intergenic
1197313308 X:124932574-124932596 GTGGAAGTCAGAAGTTGTGAAGG + Intronic