ID: 1081496504

View in Genome Browser
Species Human (GRCh38)
Location 11:43616529-43616551
Sequence GAAGCACTTAGAACAATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4199
Summary {0: 2, 1: 41, 2: 227, 3: 911, 4: 3018}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081496504_1081496505 19 Left 1081496504 11:43616529-43616551 CCAGGCATTGTTCTAAGTGCTTC 0: 2
1: 41
2: 227
3: 911
4: 3018
Right 1081496505 11:43616571-43616593 ATCTTTACAACAACACTTTATGG 0: 1
1: 1
2: 19
3: 141
4: 890
1081496504_1081496506 23 Left 1081496504 11:43616529-43616551 CCAGGCATTGTTCTAAGTGCTTC 0: 2
1: 41
2: 227
3: 911
4: 3018
Right 1081496506 11:43616575-43616597 TTACAACAACACTTTATGGCAGG 0: 1
1: 0
2: 7
3: 26
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081496504 Original CRISPR GAAGCACTTAGAACAATGCC TGG (reversed) Intronic
Too many off-targets to display for this crispr