ID: 1081496505

View in Genome Browser
Species Human (GRCh38)
Location 11:43616571-43616593
Sequence ATCTTTACAACAACACTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1052
Summary {0: 1, 1: 1, 2: 19, 3: 141, 4: 890}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081496504_1081496505 19 Left 1081496504 11:43616529-43616551 CCAGGCATTGTTCTAAGTGCTTC 0: 2
1: 41
2: 227
3: 911
4: 3018
Right 1081496505 11:43616571-43616593 ATCTTTACAACAACACTTTATGG 0: 1
1: 1
2: 19
3: 141
4: 890

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081496505 Original CRISPR ATCTTTACAACAACACTTTA TGG Intronic