ID: 1081496506

View in Genome Browser
Species Human (GRCh38)
Location 11:43616575-43616597
Sequence TTACAACAACACTTTATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 7, 3: 26, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081496504_1081496506 23 Left 1081496504 11:43616529-43616551 CCAGGCATTGTTCTAAGTGCTTC 0: 2
1: 41
2: 227
3: 911
4: 3018
Right 1081496506 11:43616575-43616597 TTACAACAACACTTTATGGCAGG 0: 1
1: 0
2: 7
3: 26
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081496506 Original CRISPR TTACAACAACACTTTATGGC AGG Intronic