ID: 1081498387

View in Genome Browser
Species Human (GRCh38)
Location 11:43639408-43639430
Sequence CAGTATCTGCTTGTTGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081498382_1081498387 -4 Left 1081498382 11:43639389-43639411 CCCTTGGCTGCTCCCACTTCAGT 0: 1
1: 0
2: 0
3: 17
4: 186
Right 1081498387 11:43639408-43639430 CAGTATCTGCTTGTTGTGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 209
1081498383_1081498387 -5 Left 1081498383 11:43639390-43639412 CCTTGGCTGCTCCCACTTCAGTA 0: 1
1: 1
2: 3
3: 15
4: 210
Right 1081498387 11:43639408-43639430 CAGTATCTGCTTGTTGTGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 209
1081498380_1081498387 12 Left 1081498380 11:43639373-43639395 CCTTTTGGTTCTGCTTCCCTTGG 0: 1
1: 0
2: 4
3: 39
4: 495
Right 1081498387 11:43639408-43639430 CAGTATCTGCTTGTTGTGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081498387 Original CRISPR CAGTATCTGCTTGTTGTGCT GGG Intronic
901904451 1:12395564-12395586 CAGTATCTGCTTCTGAAGCTGGG + Intronic
902952335 1:19895644-19895666 CAGTATCTGCTTGTGTTCTTTGG + Intronic
904410405 1:30321639-30321661 CAGCAGCTGCTTGTTCAGCTGGG - Intergenic
906050850 1:42870342-42870364 CAGTGTTTGCTTTTTGTGATTGG - Intergenic
906930928 1:50168514-50168536 CAGTATCTGCTTCTGAAGCTGGG + Intronic
907940769 1:59084756-59084778 GAGTGTCTGCTTGTTTTGCCTGG - Intergenic
909415032 1:75396604-75396626 GAGTATCTGCTGGTTTTTCTAGG + Exonic
912049233 1:105503652-105503674 TAGTAGCTGCTTGTGTTGCTAGG + Intergenic
913084847 1:115427240-115427262 TAGTAGCTGTTTCTTGTGCTTGG + Intergenic
917462352 1:175243327-175243349 CAGTATCTGCTTCTGAAGCTTGG - Intergenic
919125027 1:193382987-193383009 CAGTATGTGCTTCTGGTGCCAGG + Intergenic
920197036 1:204235445-204235467 CAGTATCTGCTTCTGAAGCTGGG - Intronic
920537776 1:206750757-206750779 CAGGATATGCTGGCTGTGCTGGG + Intergenic
1064518039 10:16171124-16171146 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1064851250 10:19711214-19711236 CACTATCTGTTTATTGTGTTGGG + Intronic
1066627491 10:37422424-37422446 TTGTATCTGCTGGTTGTGCAGGG - Intergenic
1067125968 10:43515737-43515759 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1067223697 10:44362002-44362024 CAGTATTTGCCTGTTGTTCCAGG - Intergenic
1068135319 10:52947388-52947410 CAGCATCTACTTGTTGAGATAGG + Intergenic
1069192693 10:65509241-65509263 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1069791257 10:71022624-71022646 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1070967833 10:80540370-80540392 CAGTATCTGCTTCATGTCCTGGG + Intronic
1071937325 10:90546438-90546460 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
1072728465 10:97829122-97829144 AAGTCTCTGCCTGTTGTGTTTGG + Intergenic
1072777340 10:98212006-98212028 CAGTGTCTGGGTGTTGTGTTTGG + Intronic
1074244558 10:111675975-111675997 CAGTATGTGCTTCTGGAGCTAGG - Intergenic
1074620222 10:115111444-115111466 CAGCATCTGCTTGTATTGCGGGG + Intronic
1075606485 10:123815227-123815249 CAGTATCAGCTTGTGAAGCTGGG - Intronic
1078481180 11:11677073-11677095 CAGGCTCTGCTTGCTGTGCTGGG - Intergenic
1079015152 11:16862421-16862443 AAGTAGCTGCTTGTTAAGCTAGG - Intronic
1081498387 11:43639408-43639430 CAGTATCTGCTTGTTGTGCTGGG + Intronic
1082999237 11:59276649-59276671 CAGTATCTGCTTTTGAAGCTGGG - Intergenic
1086961940 11:92986748-92986770 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1088000185 11:104869948-104869970 CAGTATTTGCTTTTTGAGCCTGG - Intergenic
1088297978 11:108321705-108321727 CAACCTCTGCCTGTTGTGCTGGG - Intronic
1088407989 11:109501565-109501587 CAGTATCTGCTTCTGAAGCTAGG + Intergenic
1089326055 11:117657938-117657960 CAGTCTGTGCTCATTGTGCTGGG - Intronic
1092008756 12:5091333-5091355 TTGTATCTGCTTCTTTTGCTTGG + Intergenic
1092589612 12:9939397-9939419 CAGTATCTCCCTATTTTGCTTGG + Intergenic
1093035870 12:14332134-14332156 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
1094398498 12:30034836-30034858 CTGTTTCTTCTTGTTGTGCAGGG + Intergenic
1094702785 12:32886607-32886629 CAATATCTGGTTGTTCTTCTTGG - Intronic
1095856605 12:46866558-46866580 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1099859777 12:88211512-88211534 CAGTATCTGCTTCTAAAGCTGGG + Intergenic
1100082946 12:90875334-90875356 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
1103396115 12:120608544-120608566 CAGTATGTGCTTCTGGAGCTGGG - Intergenic
1105646228 13:22320842-22320864 TAGTATCTGCTTGTTGTTGCTGG - Intergenic
1106784328 13:33092053-33092075 CAGTAAATGCTTGATGGGCTTGG + Intergenic
1107431073 13:40340854-40340876 CAGTGTCTGCTTTTCTTGCTTGG + Intergenic
1111016563 13:82388734-82388756 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1114626131 14:24131526-24131548 CACTAACTGCTTGCTTTGCTGGG - Exonic
1117057782 14:51930755-51930777 CAGTATCTGCTTCTTGTGAGGGG + Intronic
1119107872 14:71941059-71941081 CAGTATCTGCTTCTGAAGCTGGG + Intronic
1119421575 14:74510598-74510620 CAGAAGCTGCTTGTTGGGTTGGG - Intronic
1121559178 14:94861901-94861923 CAGAATAAGGTTGTTGTGCTAGG + Intergenic
1122064785 14:99165257-99165279 CAGTAGCTCCTAGTTTTGCTGGG + Intergenic
1125553203 15:40563408-40563430 CAGTATCTGCCTTTTGTGTATGG - Intronic
1126620141 15:50630359-50630381 CAGTATCCTCTTAATGTGCTGGG + Intronic
1127175550 15:56351534-56351556 CAGTATCTGCATATTGTGTAAGG + Intronic
1127515365 15:59688862-59688884 CCGTTTCTGGTAGTTGTGCTCGG - Intronic
1127658802 15:61080842-61080864 CAGTATCTTCTTGCTCTCCTGGG + Intronic
1129961785 15:79692963-79692985 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1131178151 15:90222868-90222890 CAGTGACTCCTTCTTGTGCTGGG - Intronic
1133802074 16:9092199-9092221 CAGCTTCTGCTGCTTGTGCTCGG - Exonic
1135216346 16:20574841-20574863 CAGTATCTGCTTCTGAAGCTGGG + Intronic
1137005078 16:35268644-35268666 CAGCATCTACTTGTTGAGGTAGG + Intergenic
1137891171 16:52163348-52163370 CAGTTTATACTTGTTTTGCTGGG + Intergenic
1138935013 16:61709037-61709059 CAGTTTCTGCTTGTTGTTTGGGG + Intronic
1139848653 16:69937618-69937640 CTGGATCTGCTTGCTGTTCTTGG - Exonic
1140543442 16:75782237-75782259 CAGTTTCTGCTTGTTTTTCCAGG - Intergenic
1140875378 16:79146816-79146838 CAGTATTTGCTACTTCTGCTGGG - Intronic
1147054805 17:37825936-37825958 CAGTATCTGTTGGTTCTGATAGG + Intergenic
1151038003 17:70823120-70823142 CAGTATCTGCTTCTGAAGCTAGG + Intergenic
1151296694 17:73191545-73191567 CAGTATCTCCTTTCTGTGATTGG - Intergenic
1153155722 18:2146613-2146635 TAGTATGTGCTTGTAGTCCTAGG - Intergenic
1153218098 18:2838512-2838534 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1156440211 18:37178335-37178357 CAGTATTTGTTTTTTGTGCCCGG + Intronic
1156583989 18:38411318-38411340 TAGTATCTGTTTGTTTTGATTGG + Intergenic
1161792108 19:6366331-6366353 CAGGCTCTGTTTGGTGTGCTTGG - Exonic
1164213782 19:23124935-23124957 CAGTTTCTACATGTTGTGGTAGG + Intronic
1165273065 19:34726725-34726747 CAGCATCTACTTGTTGAGATAGG - Intergenic
1168307995 19:55446193-55446215 CAGTATTTGGCTGTTGTGCAAGG - Intergenic
926019622 2:9483691-9483713 CAGTATCTGGGGATTGTGCTAGG - Intronic
929369557 2:41206112-41206134 CAGTTTATGTTTGTTGTGTTTGG + Intergenic
929943463 2:46352674-46352696 CAGCACCTGCTTGTTCTCCTGGG - Intronic
935153239 2:100458784-100458806 CAGTTAATGCTTGTTCTGCTTGG - Intergenic
936720750 2:115250096-115250118 CATTATCTGCTCATTGTCCTTGG + Intronic
938660355 2:133480383-133480405 GAGTATCTGTTGGTTTTGCTTGG + Intronic
939789055 2:146548982-146549004 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
940264945 2:151827446-151827468 CAGTTTTTGTTTGTTTTGCTGGG - Intronic
940806659 2:158194998-158195020 CAGTCTCTGCTTGTCTCGCTGGG + Intronic
941125716 2:161580825-161580847 CAGATCCTGCTTGTTGTACTAGG - Intronic
941338689 2:164278087-164278109 CAGTATTTGTTTTTTGTGCCTGG + Intergenic
941403031 2:165055279-165055301 CAGCAACTGATTCTTGTGCTAGG + Intergenic
941660625 2:168192270-168192292 TAGAATCTGCTTGTGGTGTTGGG - Intronic
941667569 2:168257913-168257935 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
942173319 2:173308210-173308232 CTGTACCTGCTTGTGGAGCTTGG - Intergenic
942698987 2:178681880-178681902 CAATATGAGCTTGTTCTGCTTGG - Intronic
943136812 2:183923974-183923996 CAATTACTGCTTGTTGTGATTGG - Intergenic
945010005 2:205450769-205450791 CAGAATCTGCCTGTTGGGCTGGG - Intronic
946137715 2:217661806-217661828 CAGTGTCTCCTTGCTGTTCTTGG + Intronic
946330329 2:219005460-219005482 CAGGAGCTGCTTCTTCTGCTTGG + Exonic
1171296310 20:24020186-24020208 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
1173411708 20:42817013-42817035 CAGCCTCTGCTTCTTGTTCTAGG - Intronic
1173709518 20:45142138-45142160 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1175877193 20:62235956-62235978 GAGTGCCTGCTTGTTGTGCCTGG + Intronic
1178035435 21:28577299-28577321 CAGCATCTACTACTTGTGCTGGG + Intergenic
1183682475 22:39341121-39341143 CATTTTCTGCTTGTTGTGATTGG + Intergenic
1184603954 22:45561304-45561326 CAGTATCTGCTTCTGAAGCTGGG + Intronic
949126042 3:446051-446073 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
951122211 3:18942676-18942698 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
951384158 3:22024854-22024876 CAGTATCTGCTTCTGAAGCTGGG - Intronic
951679312 3:25278223-25278245 AAGTATCTGCTTCTAGAGCTGGG + Intronic
952848723 3:37710689-37710711 CGGTTTCTGCCTGTTGTCCTAGG - Intronic
956456699 3:69428322-69428344 CAATATCTCCTAGTTCTGCTGGG + Intronic
957897744 3:86445839-86445861 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
959064259 3:101641005-101641027 CAGCATCTACTTGTTGAGATAGG - Intergenic
959133777 3:102391504-102391526 CAGTTTCTGCTTGGTTTTCTTGG + Intronic
960739974 3:120822374-120822396 AAGAATATGCTTGTTGTGTTGGG + Intergenic
963356045 3:144209749-144209771 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
965034917 3:163425398-163425420 CAGTATCTGCTTTTGAAGCTAGG + Intergenic
965050321 3:163638531-163638553 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
965794229 3:172422191-172422213 CAGTATATCCTTTTTGTGCCTGG + Intergenic
966103285 3:176302616-176302638 CAGTATTTTCTTTTTGTGATTGG + Intergenic
967497345 3:190156417-190156439 AATTCTCTGCTTGTTGTGGTTGG - Intergenic
968524500 4:1049161-1049183 CAGGAGCTGCTGGCTGTGCTGGG - Intergenic
969901982 4:10358517-10358539 CCATATCTGCTTTTTGTGCAAGG + Intergenic
969931606 4:10636403-10636425 CAGTATTTGCTGGCTGTCCTTGG - Intronic
970876844 4:20881104-20881126 CACTGCCTGCTTCTTGTGCTGGG - Intronic
972685106 4:41345103-41345125 TAGTTTCTGCTTGATGTTCTGGG - Intergenic
973102632 4:46292230-46292252 CAGTATCTGCTTGTGAAGCCTGG - Intronic
975912237 4:79280624-79280646 CAGTTTCTGTTTCTTGTGCCTGG + Intronic
977490465 4:97702967-97702989 CAGTATCTGCTTCTGAGGCTGGG + Intronic
977626987 4:99198227-99198249 CAGTATCTGCTTCTGATGCCTGG + Intergenic
980610645 4:135156837-135156859 CAGTATTTGCTTTCTGTGCTTGG - Intergenic
980957391 4:139443486-139443508 CAGTATCTGCTTCTGGAGCGAGG - Intergenic
982204730 4:152989297-152989319 CTGTATCTGCTTGGTGACCTTGG + Intergenic
982249333 4:153388820-153388842 CAGTATATTCTTGTTCTTCTTGG - Intronic
986003020 5:3644849-3644871 CAGTTTCTGTTGGGTGTGCTTGG - Intergenic
986086736 5:4459805-4459827 CAGTATCTGCTTCTGGAGTTGGG - Intergenic
987414708 5:17650742-17650764 CAATATCTGCGAGTTGTGCTGGG - Intergenic
987504029 5:18746948-18746970 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
987822017 5:22977718-22977740 AAGTATCTCCTTGTTATCCTCGG - Intergenic
988080186 5:26404324-26404346 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
989458026 5:41664679-41664701 CAGTATCTGCTTATGAAGCTGGG + Intergenic
989971439 5:50529686-50529708 CATTATCTGCATTTTGTCCTAGG + Intergenic
994958085 5:106561425-106561447 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
995295913 5:110521616-110521638 TTGGATCTGCTTTTTGTGCTTGG + Intronic
996165355 5:120215617-120215639 CAGTATTTGCTTATGGAGCTGGG + Intergenic
998290724 5:140911505-140911527 CAGTATCTGCTTCTGAAGCTAGG + Intronic
1000223676 5:159237512-159237534 CAGTATCTGCTTCTGGAGCCAGG + Intergenic
1002468899 5:179422943-179422965 CAGCATCTGCATGGTGTCCTCGG - Intergenic
1003110246 6:3247193-3247215 CAGTAGCTGCTTGTTGGGGTAGG - Intronic
1004107363 6:12678173-12678195 CAGCATGAGCTTGTTGTGCCAGG - Intergenic
1006061969 6:31430241-31430263 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
1008698796 6:54074188-54074210 CAGTATGTTCCTGTTGTGATAGG + Intronic
1010818211 6:80385194-80385216 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
1012411582 6:98964489-98964511 CTGTAGCTGCTTGTTTTCCTAGG - Intergenic
1012820431 6:104080036-104080058 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
1013210903 6:107985887-107985909 CACTTTCTGCTTGATCTGCTGGG + Intergenic
1015183038 6:130381577-130381599 CATTCTCTGATTGTTGTACTGGG - Intronic
1016120282 6:140335554-140335576 CAGTATGTGCTTCTGGAGCTGGG + Intergenic
1016147677 6:140695623-140695645 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1017620384 6:156290511-156290533 CTATATCTGCTTGTTGGGCTGGG - Intergenic
1017745582 6:157444272-157444294 CAGTCTCTGCCTTTTGTGATTGG + Intronic
1017780928 6:157714739-157714761 CAGTACCTGCTTCTTGACCTTGG - Intronic
1019926143 7:4193766-4193788 CAGTATCTGCTTCTGAAGCTGGG + Intronic
1020709940 7:11594699-11594721 CAGTATCTGCTTATGAAGCTAGG - Intronic
1023108851 7:36789891-36789913 CTCTTTCTGCTTGTTGTGATGGG + Intergenic
1023754112 7:43399904-43399926 CAGTATTTGCTTTTTGTCCTAGG - Intronic
1025923228 7:65934626-65934648 CAGTATTTGCTTTCTGTGCCAGG + Intronic
1026241539 7:68579733-68579755 TAGGATCTCCTTGTTGTCCTAGG + Intergenic
1026266802 7:68802346-68802368 CAGTATTTTTTTGTTGTGTTTGG - Intergenic
1027252566 7:76408408-76408430 CAGTCTTTGCTTGTTGTGGGGGG + Intronic
1027678914 7:81194504-81194526 CAGTATCTGCATGTTAGGCAAGG + Intronic
1028366534 7:90038860-90038882 CATTATCTGCTGGATGTCCTGGG - Intergenic
1029518437 7:101043456-101043478 CAGCCTCTGCTGGTTGTTCTGGG - Exonic
1030571806 7:111235673-111235695 CTGTATCATCTTCTTGTGCTTGG + Intronic
1030989990 7:116288226-116288248 GTGAATGTGCTTGTTGTGCTGGG - Intronic
1032153499 7:129449851-129449873 CAGTATCTGCTTCTGAAGCTGGG + Intronic
1032991932 7:137403419-137403441 CAGTTGCTGCTTGTTGTGTCTGG + Intronic
1033754473 7:144386713-144386735 CATTAAATGCTTGTTGTGGTTGG + Intergenic
1034169501 7:149052111-149052133 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
1036522448 8:9504545-9504567 CAGGACCTCTTTGTTGTGCTCGG - Intergenic
1037291671 8:17356563-17356585 CATTATCTGGTTGTGGTGGTGGG + Intronic
1039148395 8:34476233-34476255 CACTATCTGCTTATTGTGGTAGG - Intergenic
1042752572 8:72174350-72174372 CATTAAATGCTTGGTGTGCTTGG - Intergenic
1042770012 8:72369562-72369584 CAGTATTTAATTATTGTGCTTGG - Intergenic
1043260331 8:78187065-78187087 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1043402108 8:79893912-79893934 CTGTCACTTCTTGTTGTGCTTGG - Intergenic
1043500059 8:80844562-80844584 CCCTATCTGGTTGTTGTGGTAGG - Intronic
1044529169 8:93288870-93288892 CAGACTCTGCTTATAGTGCTAGG + Intergenic
1045407119 8:101877843-101877865 CAGTATTTGCTTGTTTTGATGGG - Intronic
1046214928 8:111131596-111131618 CAGTATTTGTCTGTTGTGCCAGG - Intergenic
1046389489 8:113551049-113551071 TAGTGTCTGCCTGTTCTGCTTGG + Intergenic
1048876825 8:138843191-138843213 CAGCATCTGCATCTTGTGCCTGG - Intronic
1050097219 9:2079110-2079132 CCGTATCTGGTTGTTGTTCAGGG - Intronic
1050656479 9:7833979-7834001 TAGTATCTGCCTGTTGCTCTGGG + Intronic
1051881749 9:21847724-21847746 CAGTATCTGCTGCTGGAGCTGGG - Intronic
1052151814 9:25126430-25126452 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1052735667 9:32339883-32339905 CAGTATGTGCTTTTTCTGTTTGG - Intergenic
1052789362 9:32860183-32860205 CAGTATGTGCTTCTGGGGCTGGG + Intergenic
1057209708 9:93193111-93193133 CAGCATCTGCTTGCTGTGGTGGG + Intronic
1058351380 9:104028749-104028771 CAGTTTCTGCTTGTGGTGGGGGG + Intergenic
1059250786 9:112886425-112886447 CAGCATCTGCTGCTTGGGCTGGG - Intronic
1062340380 9:136091421-136091443 CAGTGTCTGCTTGCTGGGCCTGG - Intronic
1062388387 9:136324270-136324292 CAGTAGCTGCTTGTTGGGGAAGG + Intergenic
1186294786 X:8137242-8137264 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1189831552 X:44979618-44979640 CAGTTTGTGCTTTTTGTGCTAGG + Intronic
1191780150 X:64856048-64856070 CAGTGTCTGCGTAGTGTGCTGGG - Intergenic
1192052029 X:67733083-67733105 CAGCATCTGCTTGCTCTGCTGGG - Intergenic
1192488338 X:71550797-71550819 CAGTATCTACTTTCTGTGCCTGG - Intronic
1193915250 X:87355128-87355150 CAGTATGTGCTTGTGGAGCCAGG + Intergenic
1194513786 X:94825160-94825182 CAGTATCTGCTTCTGATGCCAGG + Intergenic
1196275434 X:113761194-113761216 CAGTATCTGCTTCTAAAGCTGGG - Intergenic
1197044090 X:121975529-121975551 CAGTATGTGCTTCTGGAGCTGGG - Intergenic
1197404716 X:126036269-126036291 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
1197495582 X:127174658-127174680 CAGTATATGCTCGTTCTTCTTGG - Intergenic
1197591484 X:128416430-128416452 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
1197956172 X:131950955-131950977 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
1198331101 X:135623653-135623675 TAGAATCTGCATGTTGTTCTTGG - Intergenic
1198363630 X:135919786-135919808 TAGAATCTGCATGTTGTTCTTGG - Intergenic
1198933626 X:141884890-141884912 CAGTATCTGCTTCTGGAGCCAGG - Intronic
1199256640 X:145725469-145725491 CAGCCTCTTCTTGTTGTGGTTGG + Intergenic
1199673705 X:150166946-150166968 CAGTATCTTCTTGGTGTGACAGG - Intergenic