ID: 1081500953

View in Genome Browser
Species Human (GRCh38)
Location 11:43666162-43666184
Sequence CCAGATATTGAGAAAATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 268}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081500953_1081500961 -8 Left 1081500953 11:43666162-43666184 CCCTCCATTTTCTCAATATCTGG 0: 1
1: 0
2: 1
3: 22
4: 268
Right 1081500961 11:43666177-43666199 ATATCTGGGTGCTAGGAAAGGGG 0: 1
1: 0
2: 2
3: 11
4: 254
1081500953_1081500959 -10 Left 1081500953 11:43666162-43666184 CCCTCCATTTTCTCAATATCTGG 0: 1
1: 0
2: 1
3: 22
4: 268
Right 1081500959 11:43666175-43666197 CAATATCTGGGTGCTAGGAAAGG 0: 1
1: 0
2: 0
3: 15
4: 160
1081500953_1081500964 23 Left 1081500953 11:43666162-43666184 CCCTCCATTTTCTCAATATCTGG 0: 1
1: 0
2: 1
3: 22
4: 268
Right 1081500964 11:43666208-43666230 ATTTTTATTTTTTTGAGGCAGGG 0: 10
1: 313
2: 2572
3: 21411
4: 31771
1081500953_1081500963 22 Left 1081500953 11:43666162-43666184 CCCTCCATTTTCTCAATATCTGG 0: 1
1: 0
2: 1
3: 22
4: 268
Right 1081500963 11:43666207-43666229 TATTTTTATTTTTTTGAGGCAGG 0: 13
1: 271
2: 1911
3: 20246
4: 31945
1081500953_1081500960 -9 Left 1081500953 11:43666162-43666184 CCCTCCATTTTCTCAATATCTGG 0: 1
1: 0
2: 1
3: 22
4: 268
Right 1081500960 11:43666176-43666198 AATATCTGGGTGCTAGGAAAGGG 0: 1
1: 0
2: 0
3: 20
4: 192
1081500953_1081500962 18 Left 1081500953 11:43666162-43666184 CCCTCCATTTTCTCAATATCTGG 0: 1
1: 0
2: 1
3: 22
4: 268
Right 1081500962 11:43666203-43666225 TATTTATTTTTATTTTTTTGAGG 0: 11
1: 129
2: 593
3: 9778
4: 37566

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081500953 Original CRISPR CCAGATATTGAGAAAATGGA GGG (reversed) Intronic
900787300 1:4656595-4656617 CCTGATTTTGAGAAATCGGAAGG + Intronic
902419355 1:16265940-16265962 AGTGATATTGAGAAAATGGTAGG - Intronic
902779027 1:18692802-18692824 CCATATATTGAGGCCATGGAGGG - Intronic
903672353 1:25044043-25044065 TCAAATAGGGAGAAAATGGAAGG + Intergenic
906346187 1:45016147-45016169 CAAGATCTTGAGAAAATTAAAGG - Intergenic
908952314 1:69576272-69576294 CCAGATATTTAGAAGAAGGAAGG - Intronic
910386626 1:86690733-86690755 CCAGATATTGAGACAATAATTGG + Intergenic
910602457 1:89046542-89046564 CTTGATATTGAGATTATGGAGGG + Intergenic
910745416 1:90569110-90569132 GAAGGTATTAAGAAAATGGAAGG - Intergenic
912017991 1:105066127-105066149 CAAGATGTTGAGAAAGGGGAAGG - Intergenic
915793766 1:158704268-158704290 GCAGAAATTCAGAAATTGGAGGG - Intergenic
916093788 1:161330394-161330416 TCAAAAAGTGAGAAAATGGAAGG + Intronic
916671671 1:167027675-167027697 AAAATTATTGAGAAAATGGAGGG + Intergenic
917211741 1:172638712-172638734 CTAGATAGTGAGTAAATTGAGGG + Intergenic
917531326 1:175837996-175838018 CCAGATATAAAGAAAATAAATGG - Intergenic
918509476 1:185294720-185294742 ACAGATTATTAGAAAATGGATGG + Intergenic
918668432 1:187180486-187180508 CCAAATATTGACAGAATTGAAGG - Intergenic
920841416 1:209558022-209558044 CCAGAAATTGAGAAAGGGAATGG + Intergenic
923293191 1:232567486-232567508 ACAGAAATTGGAAAAATGGAAGG + Intergenic
1063225018 10:4007520-4007542 CCAGATTCTGAGAAGATGGAGGG - Intergenic
1063455988 10:6182955-6182977 CCACAGGTTGAGAACATGGATGG + Intronic
1064413037 10:15124785-15124807 ACAGATATTATGAAATTGGAAGG - Intronic
1068381251 10:56255813-56255835 CCAGAGAGTGAGAAAAAGCAGGG - Intergenic
1071874302 10:89827653-89827675 TCACGTATTGACAAAATGGAAGG - Intergenic
1072304573 10:94095099-94095121 CCAGCTATAAAGAAAATAGAGGG - Intronic
1073550683 10:104398084-104398106 ACAGATATTGCCAACATGGAAGG - Intronic
1074856770 10:117479741-117479763 CCAGGTATAGAGCAAAAGGAAGG + Intergenic
1078604828 11:12765863-12765885 CCAGACATAGAGAAAATCTAGGG - Intronic
1079853733 11:25573125-25573147 CCAGCTATTGAAATAAAGGAAGG + Intergenic
1080413657 11:32049817-32049839 CCAGAAAATGAGAAAGTGGGTGG - Intronic
1081500953 11:43666162-43666184 CCAGATATTGAGAAAATGGAGGG - Intronic
1081960046 11:47129360-47129382 CCCATTATTGAGGAAATGGAAGG - Intronic
1082070914 11:47938868-47938890 ACAGTTATTGAGTGAATGGAGGG + Intergenic
1082756836 11:57084874-57084896 TTAAATATTGAGGAAATGGATGG - Intergenic
1084462024 11:69301611-69301633 CCAGACATTTAGAAAATGGTGGG - Intronic
1084978990 11:72818727-72818749 ACAGATGTTGAGAGAATGAATGG - Intronic
1085143097 11:74167031-74167053 GCAAATATCTAGAAAATGGAAGG + Intronic
1086343044 11:85866897-85866919 CCAGAAACTGAGAAAAGGGAGGG + Intronic
1086897812 11:92333956-92333978 ACAGTTAGTGAGAAAATTGAGGG + Intergenic
1087344732 11:96957147-96957169 CCAGATCTTGAGAATATAGGAGG - Intergenic
1088861484 11:113804209-113804231 CCAGATATTGAAAATATGGAAGG + Intronic
1090666102 11:128916067-128916089 CCAGATATGGAAAAAAAGGCAGG - Intronic
1090666120 11:128916163-128916185 CCAGATATGGAAAAAAAGGCAGG - Intronic
1090864104 11:130681035-130681057 GCAAATATTGACAAAATTGAAGG + Intronic
1091076248 11:132620340-132620362 TCAGCTCTTGAGAAATTGGATGG + Intronic
1095805838 12:46320319-46320341 CCAGAAATTGAGAAACTGGCAGG + Intergenic
1096729580 12:53597471-53597493 GCAGATATTGACATAATGCAAGG + Intronic
1096930711 12:55205833-55205855 CCAAATATTCAAAAAATGGAAGG + Intergenic
1097278397 12:57828735-57828757 CCTGGTCTTGAGAAAAAGGAAGG + Intronic
1097964165 12:65561387-65561409 CCAAATATTGTGAGCATGGATGG - Intergenic
1098614461 12:72506194-72506216 CCAGCTATTCAGAAAGTTGATGG + Intronic
1098754504 12:74342341-74342363 CTATATATTTATAAAATGGAAGG - Intergenic
1099026182 12:77467390-77467412 CCAAATGTTAAGAATATGGAAGG - Intergenic
1100002422 12:89853504-89853526 GCACATATTGAGAATCTGGATGG - Intergenic
1105576530 13:21658440-21658462 CCAGATCTTGAGAAAAAACAGGG + Intergenic
1105811500 13:24000355-24000377 CCAGTGATGGAGAATATGGAAGG + Intronic
1105836029 13:24212736-24212758 CCAGATATTGAAAAAAAGAAAGG + Intronic
1106104275 13:26720375-26720397 TCAGATATTGATAAAATAAATGG + Intergenic
1106333375 13:28761289-28761311 CCAGACTTTGAGGAAATGGGAGG - Intergenic
1107094708 13:36523218-36523240 TCAGATACTGAGGAAATGTAAGG - Intergenic
1107204282 13:37763240-37763262 AAAGATATTGAGAAAATAGATGG + Intronic
1107415486 13:40196100-40196122 ACAGATTTGGAGAAAATGCAGGG + Intergenic
1108225326 13:48283746-48283768 CCAGATATTTTGAAAATAAAAGG - Intergenic
1108915116 13:55599874-55599896 GCAGATATTGAGAAAGCAGAAGG + Intergenic
1109832861 13:67814822-67814844 CAAGATGTTAAGAAAATGGGGGG + Intergenic
1111479338 13:88802639-88802661 CAAGATATTGTGAAAAGGCATGG + Intergenic
1111944536 13:94650314-94650336 CCAGATCTTGTGAACATGTAAGG - Intergenic
1111979239 13:94999913-94999935 CCAGATCCTGAAAAACTGGAAGG + Intergenic
1112368394 13:98774370-98774392 TCCCATATTGAAAAAATGGATGG + Intergenic
1114553501 14:23548013-23548035 TCAGGGATTGAGAAAAGGGAAGG - Intronic
1115115376 14:29875221-29875243 CCAGAGATAGATAAAATGGTGGG + Intronic
1115453535 14:33575880-33575902 CCTGAGAAAGAGAAAATGGAAGG + Intronic
1115926817 14:38445235-38445257 CCAGATGTAGAAAAAAGGGAAGG - Intergenic
1120296848 14:82652274-82652296 CCAGGTATTAAGGAAAGGGAAGG - Intergenic
1120375341 14:83697463-83697485 CCAGGTCTTAAGAGAATGGATGG - Intergenic
1121152370 14:91647321-91647343 CCAGGTAGTGAGAATATAGATGG - Intronic
1121238262 14:92409236-92409258 AGAGATATTGAGCAACTGGATGG + Intronic
1124128641 15:26964843-26964865 ATAGATATTAAGAAAATGAAAGG + Intergenic
1124802572 15:32848404-32848426 CCAGTCAATGAGAAAATGCAAGG - Intronic
1125017194 15:34948126-34948148 GCAAATATTGAGAAAAAGAATGG - Intronic
1125367265 15:38931705-38931727 CAAAGAATTGAGAAAATGGATGG - Intergenic
1125579131 15:40773492-40773514 CCAGATATGGAGAGAAAGCAAGG + Intronic
1126761244 15:51971926-51971948 ACAGATATTGACGAAATGGCCGG - Intronic
1126860016 15:52874260-52874282 ACAGATTTTGGGATAATGGAAGG + Intergenic
1127010691 15:54624074-54624096 ACAGATATTGAATGAATGGAAGG - Intronic
1128703958 15:69825048-69825070 ACAGATATTGTGAAACTGGAGGG + Intergenic
1128906844 15:71474877-71474899 CCAGAACTAGAGAGAATGGAGGG - Intronic
1129965338 15:79729925-79729947 GCAGGGATTGAGAGAATGGAAGG + Intergenic
1130223332 15:82039745-82039767 CCAGAGATTGCCAAAATGGAGGG + Intergenic
1131469101 15:92680536-92680558 TGGGATATCGAGAAAATGGATGG - Intronic
1137949954 16:52774218-52774240 CCAGCTATTCAGAAGGTGGAAGG + Intergenic
1140648569 16:77062562-77062584 ACAGAAATTGAGGACATGGAAGG - Intergenic
1141300536 16:82811620-82811642 CCAGAAAATGAGAAAAAAGAGGG + Intronic
1142917754 17:3155917-3155939 CCACAGAATGAGAAAAAGGAAGG + Intergenic
1144622521 17:16826873-16826895 TCAGAAAGAGAGAAAATGGAGGG + Intergenic
1144883907 17:18445837-18445859 TCAGAAAGAGAGAAAATGGAGGG - Intergenic
1145148325 17:20498540-20498562 TCAGAAAGAGAGAAAATGGAGGG + Intergenic
1145734640 17:27219104-27219126 CTACATACTGATAAAATGGAAGG + Intergenic
1146067238 17:29645819-29645841 CCAAATGTTGAGTAAATGGGAGG + Intronic
1146205338 17:30900184-30900206 GCAGATACTGAGAAAATCAATGG - Intronic
1146225325 17:31061125-31061147 CTACATACTGATAAAATGGAAGG - Intergenic
1146820923 17:35983084-35983106 CCAGGTGTTCAGGAAATGGATGG - Intergenic
1146866678 17:36342078-36342100 GTAGATATGGAGAAAATGGAAGG - Intronic
1147069546 17:37942687-37942709 GTAGATATGGAGAAAATGGAAGG - Intergenic
1147081076 17:38022225-38022247 GTAGATATGGAGAAAATGGAAGG - Intronic
1147097018 17:38146182-38146204 GTAGATATGGAGAAAATGGAAGG - Intergenic
1147116784 17:38306430-38306452 ACAGTTATTGAGTAAGTGGATGG + Intronic
1147414933 17:40281797-40281819 CCAGAGCTTCACAAAATGGAAGG - Exonic
1147576860 17:41606798-41606820 TCAGAAAGAGAGAAAATGGAGGG + Intergenic
1148722839 17:49766925-49766947 CCAGAAATTAAGAACCTGGACGG + Intronic
1148822856 17:50370454-50370476 CAAGGCATTAAGAAAATGGAAGG - Exonic
1149573587 17:57695456-57695478 CCTCATCTTCAGAAAATGGAGGG - Intergenic
1149729729 17:58933296-58933318 CCAAATATTGGGAGAATTGAGGG + Intronic
1149889863 17:60378303-60378325 GTAGATATGGAGAAAATGGAAGG + Intronic
1150563371 17:66315301-66315323 CCACATAGTTAGAAAATGGTGGG + Intronic
1152349539 17:79777346-79777368 CCCGATTTTGATGAAATGGAGGG - Intergenic
1154508148 18:15062634-15062656 CAAGATATAGAGAAAAGGGAGGG + Intergenic
1154983081 18:21520587-21520609 CCTGAAATAGAGAAAAAGGAAGG + Intronic
1155797103 18:30054127-30054149 TCAGATGTAGAGAAAATGAAGGG - Intergenic
1157489337 18:48111465-48111487 CCAAATATTGAGGAAATGGGGGG - Intronic
1157742579 18:50106594-50106616 CCAGATAATGAGAAATAGGGTGG - Intronic
1159368488 18:67501148-67501170 GCAGACAATGTGAAAATGGAAGG + Intergenic
1162636217 19:11969646-11969668 CCATATATTTGGAAAATGTAAGG - Intronic
1162651681 19:12093287-12093309 CCACAGATTTGGAAAATGGAGGG - Intronic
1162656318 19:12133544-12133566 ACATAAATTGAGAAAATAGAAGG + Exonic
1164518443 19:28957008-28957030 CCAAATATTTAAAAAATAGAGGG - Intergenic
1165722138 19:38087012-38087034 CCAGATATTGAGGATAAGGTTGG + Intronic
1168507061 19:56945142-56945164 CCAGATGTTTCGAAAATGGTTGG - Intergenic
925751818 2:7096135-7096157 GCAAATATTGAGACATTGGATGG + Intergenic
926281198 2:11448125-11448147 ACAGGTCTTGAGATAATGGAAGG + Intronic
926622092 2:15055834-15055856 ACATATATTGTGAAAATGTATGG + Intergenic
926838733 2:17053969-17053991 CCAGATCTTGACAAAATTCAAGG + Intergenic
928705548 2:33945996-33946018 ACAGATAGTGAGCAAATGAAGGG + Intergenic
930641468 2:53858601-53858623 ACAGAAATCAAGAAAATGGAGGG + Intronic
932882028 2:75511585-75511607 GCAGATATTAAGAAAATACAAGG - Intronic
933081711 2:77996808-77996830 CAAGATCGTGAGAACATGGAGGG - Intergenic
933136963 2:78749775-78749797 ACAGATAATCATAAAATGGAAGG + Intergenic
935033797 2:99348130-99348152 TCAGATATTTAGAAAATAAAGGG + Intronic
936265757 2:111005052-111005074 ACAGAAATTGGGCAAATGGAAGG + Intronic
938118301 2:128617034-128617056 GCAGATACTGGGGAAATGGATGG + Intergenic
938364177 2:130720816-130720838 CCAGAAATTGAAAGAAAGGAGGG + Intergenic
939324614 2:140672167-140672189 TCAAAAATGGAGAAAATGGAAGG + Intronic
939791889 2:146587958-146587980 GGAGCTATTGAAAAAATGGATGG + Intergenic
941232073 2:162923315-162923337 ACAGATGTTTAGAAAATGTATGG + Intergenic
941736646 2:168984383-168984405 CCAGACACTTAGAAAATGCAGGG - Intronic
943171169 2:184402396-184402418 CCATAAAATGAGAATATGGAAGG + Intergenic
943292985 2:186099389-186099411 ACAGATATTGAGATAGTGGAAGG - Intergenic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
943823668 2:192360736-192360758 TGAGAGAATGAGAAAATGGAAGG + Intergenic
943976465 2:194484729-194484751 TCAGAACCTGAGAAAATGGAAGG - Intergenic
946232262 2:218298975-218298997 CCTGAAATTGAGATTATGGAGGG - Intronic
946467316 2:219923486-219923508 ACCTATATAGAGAAAATGGAGGG + Intergenic
1168863900 20:1067749-1067771 AGAGATATTGAGACAAGGGAGGG - Intergenic
1168989429 20:2081429-2081451 CCAGACATTGAGGAGGTGGAGGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170317900 20:15062242-15062264 CCAGGTGTTGAGAAATAGGATGG + Intronic
1172159664 20:32858100-32858122 CTAGATATTAATAAATTGGAAGG - Intergenic
1173731178 20:45329732-45329754 CCAGGTGTTGACAAAAGGGATGG - Intronic
1173834480 20:46116344-46116366 CCAGAAATTGAGAGCTTGGAGGG + Intergenic
1176789933 21:13309159-13309181 CAAGATATAGAGAAAAGAGAGGG - Intergenic
1177328560 21:19627189-19627211 CCAGAGATGGAGAAAAAGAAAGG + Intergenic
1177950062 21:27524013-27524035 CCAGAAATTGACAGAATGGGAGG - Intergenic
1177989111 21:28017357-28017379 CAAGATATAGAGAAAAGAGAAGG - Intergenic
1179257047 21:39726292-39726314 CCAGAAATTCAGAAATTAGATGG + Intergenic
1179389592 21:40975598-40975620 ACAGCAATTGAGAAAATGAATGG - Intergenic
1184703446 22:46193855-46193877 GCAGTTGTTGAGAAAAGGGATGG + Intronic
950622678 3:14218581-14218603 AAAGATGTTGAGAAACTGGAGGG - Intergenic
950714600 3:14838776-14838798 CCAAACAGGGAGAAAATGGAAGG + Intronic
951694316 3:25429579-25429601 CAAGATATGGAAATAATGGATGG - Intronic
951770353 3:26248967-26248989 CCAGATATTAACAAGCTGGATGG + Intergenic
951989708 3:28663087-28663109 GCATATCTTGAGAAAATGAATGG + Intergenic
952495695 3:33913950-33913972 GCAGATATGGAGGAAAGGGAGGG + Intergenic
952717509 3:36494894-36494916 TCAGATATTGAGAAACTTTAGGG - Intronic
952840937 3:37644760-37644782 CCAGATTTTGAAACCATGGAAGG - Intronic
953779555 3:45854738-45854760 GCAGATAGTGATAAAATGGTTGG - Intronic
956107587 3:65836862-65836884 CCAGATATTTACAAAAGTGATGG - Intronic
956929820 3:74030153-74030175 TCAGTTATTGTGAAAATGGCTGG + Intergenic
957271493 3:78036236-78036258 AAAGCTATTGAGAAAATGAAAGG + Intergenic
963463168 3:145643600-145643622 TCACAAATTGTGAAAATGGAGGG - Intergenic
964523219 3:157589198-157589220 CCAGATATGGAGCACATGGGAGG + Intronic
966238293 3:177727079-177727101 CAAGTCATTGAGAAACTGGATGG - Intergenic
966436623 3:179892225-179892247 CCAAATATTGAGAAGAGGAAAGG - Intronic
966660127 3:182405312-182405334 TCAAATATTGCAAAAATGGATGG - Intergenic
966786103 3:183624224-183624246 CCAAATATTGAGATAAATGAGGG - Intergenic
968073537 3:195802940-195802962 ACAGATCGTGAGAAAAGGGAGGG - Intronic
968255658 3:197268321-197268343 ACAGTTACTGAGAAAATGAAAGG - Intronic
969833064 4:9814247-9814269 CAAGAAGTTGAGAAAATGGTAGG - Intronic
969907382 4:10410010-10410032 GCAGACATTGAGACAATTGATGG + Intergenic
970725061 4:19034064-19034086 CCAGATTTTGAGAGCAAGGATGG - Intergenic
970816944 4:20167932-20167954 CCAGATTTTGAGCACAGGGAAGG + Intergenic
971300755 4:25440792-25440814 CCAGGAATTGAGAAAATGTGTGG - Intergenic
972571392 4:40313560-40313582 CCAGAAAATGAGAAAACAGATGG + Intergenic
972981177 4:44703944-44703966 CCAGGTATTAAGAACATGGGAGG + Intronic
974441523 4:61924472-61924494 GAAGATATTGAGAAATTGGCTGG - Intronic
975423555 4:74198693-74198715 CAAGCTATAGAGAAAATAGATGG + Intronic
975489769 4:74975941-74975963 CCAGAGAGTGAGAAAAAGCAAGG + Intronic
976391753 4:84512802-84512824 TCTGATACTGAGAAATTGGATGG + Intergenic
976521825 4:86037023-86037045 CTAAAAATAGAGAAAATGGAAGG - Intronic
976660457 4:87535243-87535265 TCTGAAATGGAGAAAATGGAAGG + Intergenic
977061220 4:92258942-92258964 CCAGATAATCAGAAATTAGATGG - Intergenic
977307061 4:95337609-95337631 CAATATATTTAGAAAATGTATGG + Intronic
977867633 4:102048887-102048909 CCACATTTTGAAAAAATGTAAGG + Intronic
979565983 4:122154575-122154597 GAAGAAATTGAGAAAATGGCCGG + Intronic
980315423 4:131193301-131193323 CTATATATTGTGAAAATGAATGG - Intergenic
981989906 4:150905927-150905949 TCAGATATTTTGAAAATGCAAGG + Exonic
982372220 4:154646872-154646894 ACAGAGAGTGAGAAAACGGAGGG + Intronic
982850759 4:160312479-160312501 ACAGATATTAAGAAAAGGGGTGG - Intergenic
982936662 4:161486386-161486408 ACAGATGTTGAGACAAAGGAGGG + Intronic
983070944 4:163266910-163266932 GCAGATATTGACTAAAAGGAAGG + Intergenic
983671961 4:170247709-170247731 CCAGACATTCAGCAACTGGAGGG - Intergenic
984098095 4:175456167-175456189 CAAGTGATTGTGAAAATGGAAGG - Intergenic
984918885 4:184746873-184746895 CCTGAGAAAGAGAAAATGGAAGG + Intergenic
986098951 5:4587450-4587472 CCAGCTGTAGAGAAAATGGCTGG - Intergenic
986659493 5:10046267-10046289 CCAGATTTTGAGAAACTTGTGGG - Intergenic
987148597 5:15016863-15016885 CCACAAATTAAGAAAATGAAAGG - Intergenic
987371483 5:17197427-17197449 CAACATATTGGGAAAATGCAAGG - Intronic
987523883 5:19023078-19023100 TCAGAGATTGAGAAGAAGGAGGG - Intergenic
988188154 5:27894269-27894291 GCATATATTGAGAAAAGGAATGG + Intergenic
989181802 5:38585643-38585665 CCAGATATTTCTAAAATAGAGGG + Intronic
989633008 5:43506513-43506535 ACAGAGAATGAAAAAATGGAGGG + Intronic
990719921 5:58682836-58682858 CCAAATCTTGAGAAAATATATGG - Intronic
991106085 5:62843569-62843591 CAAGATAATGAGGAAATGGCTGG + Intergenic
991724167 5:69519468-69519490 CAAGATATCCAGAAAAAGGAAGG - Intronic
992562017 5:77962219-77962241 GCAGATATTGAGAAAAGAAATGG + Intergenic
994847715 5:105011324-105011346 CCAGTTAGAGAGAAAAGGGAAGG - Intergenic
994933165 5:106216431-106216453 CAAGAAAATGAGAAAAAGGAAGG + Intergenic
995005872 5:107194796-107194818 ACAGATTTTGGGAAAATAGATGG - Intergenic
996162508 5:120182425-120182447 CCAGAAAGTAAGAAAATGGTAGG + Intergenic
996452804 5:123646098-123646120 AGAGTTATTGAGAAAAAGGAAGG + Intergenic
1001771025 5:174295878-174295900 CCAGAGATGGAGACAAAGGATGG + Intergenic
1005753917 6:28908807-28908829 TCAGATATGGAGAAAATCCAAGG - Exonic
1007995373 6:46302236-46302258 CCTGAAATGGAGAAAATGGCAGG + Intronic
1008397328 6:51024152-51024174 CCAAATATTTACAAAATGGAAGG - Intergenic
1010171934 6:72985307-72985329 TTAAATATTGAGAAAATGGAAGG + Intronic
1010404138 6:75483626-75483648 CCAGTCATTGGGAAAATAGAGGG + Intronic
1010653937 6:78489374-78489396 CTAGATATTGAGAAAATTCCTGG - Intergenic
1013551476 6:111211844-111211866 CCAGGGATGGAGAAAAAGGAAGG - Intronic
1018248127 6:161841681-161841703 CCAGATCTTGCTAAAATTGAGGG - Intronic
1018548975 6:164971522-164971544 TCCGAAATGGAGAAAATGGAAGG + Intergenic
1019882230 7:3871975-3871997 CCAGAAAATGAGAAATTGAAGGG - Intronic
1020674083 7:11159174-11159196 ACAGATATTCAAAAAATGAAAGG - Intronic
1021268189 7:18551096-18551118 ACAGATTGTGAGAGAATGGAAGG + Intronic
1021476548 7:21067889-21067911 ACAGATATAGAAAAAGTGGATGG - Intergenic
1021738728 7:23664157-23664179 CCAGTTATTCTGGAAATGGAGGG + Intergenic
1027600006 7:80228264-80228286 ACACATATAGAGAAAATGTAAGG - Intergenic
1028217367 7:88150987-88151009 CCTAATATTCATAAAATGGATGG + Exonic
1028268382 7:88757464-88757486 CCATATTTTTATAAAATGGAAGG - Intergenic
1029223429 7:99008209-99008231 CCATCTGTTGAGCAAATGGATGG + Intronic
1029612250 7:101633033-101633055 TCAGAAATTCAGAAAAGGGATGG - Intergenic
1030286773 7:107834967-107834989 TGAGAAATTGAGAAAAGGGAAGG - Intergenic
1032190385 7:129762094-129762116 TCAGATTTTGAGAATCTGGATGG - Intergenic
1033087112 7:138352883-138352905 CCAGATAGTGAGAGAGTGGAGGG + Intergenic
1036579262 8:10057449-10057471 CCACATCTTAACAAAATGGAAGG - Intronic
1036978762 8:13445023-13445045 ACAGAGATTGAGAGAAGGGAAGG + Intronic
1037148496 8:15604793-15604815 CCAAATATAGAAAAAATGTAGGG - Intronic
1037304736 8:17493555-17493577 CAAAATATTGAAAAAATGGTTGG - Intergenic
1038246767 8:25865182-25865204 ACAGCTAGAGAGAAAATGGATGG + Intronic
1041918734 8:63160919-63160941 CAAGAAACTGAGAAATTGGAGGG + Intergenic
1042754667 8:72197288-72197310 CCACAAATTGAGAAACTTGATGG + Intergenic
1042947180 8:74166873-74166895 CCAGTAAGTGAGAAATTGGAGGG + Intergenic
1043362469 8:79491433-79491455 CCAAATCTTGGGAAAAGGGAGGG - Intergenic
1045420814 8:102013223-102013245 CCAGAAATAGAGAAAAGGGGAGG - Intronic
1047184758 8:122622836-122622858 ACAGAGGTTGAGAGAATGGAGGG - Intergenic
1047578806 8:126189726-126189748 CCAGACCTTGAGTAAATGCATGG - Intergenic
1047666349 8:127095976-127095998 CCAACTATTGAGAAATTGCAGGG + Intergenic
1047827842 8:128596935-128596957 TAAGATATTGGGAAAGTGGATGG + Intergenic
1048610625 8:136018660-136018682 ACAGATATTGCCAAAATGTAGGG + Intergenic
1049861673 8:144902722-144902744 CCAGTTTTTGAGAAAAGAGAAGG + Intergenic
1051339353 9:16096954-16096976 CCAAAGGCTGAGAAAATGGAAGG + Intergenic
1051843939 9:21430351-21430373 CCACAGCTTGAGAACATGGAAGG + Intronic
1052183890 9:25565851-25565873 ACAGATATTGAAAAAATTGGGGG - Intergenic
1052245975 9:26335687-26335709 TCAGATATAGAGAAAATAGATGG + Intergenic
1052279841 9:26720234-26720256 CCAGGTTTTGCCAAAATGGAAGG + Intergenic
1056060238 9:82877816-82877838 CCAGGTGTTCAGAAAAAGGAGGG + Intergenic
1058326555 9:103705630-103705652 CTAAATTTTAAGAAAATGGAAGG + Intergenic
1062669203 9:137696708-137696730 CAAGACATGAAGAAAATGGAAGG - Intronic
1186355541 X:8785586-8785608 TGAGATATTGAGTGAATGGATGG - Intergenic
1186981410 X:14961348-14961370 CCTGATATTGGGGAAGTGGATGG - Intergenic
1187166402 X:16808113-16808135 CCAAGTATTGAGACAGTGGAAGG + Intronic
1189370315 X:40422906-40422928 CCAGGTAGTGTGGAAATGGATGG + Intergenic
1189751802 X:44230149-44230171 AAAGATCTAGAGAAAATGGAGGG - Intronic
1193364620 X:80617054-80617076 CCATTAAATGAGAAAATGGAGGG - Intergenic
1194115972 X:89899286-89899308 CCAGATATTTAGGAATTTGAAGG + Intergenic
1194433940 X:93847255-93847277 CCAGAGACTGAGAAAAGTGAAGG - Intergenic
1195325393 X:103754255-103754277 CCACTGATTGAGAAGATGGAGGG + Intergenic
1195363582 X:104107174-104107196 TGAGATTGTGAGAAAATGGATGG - Intronic
1195779169 X:108441139-108441161 CCAGATGTTAAAAAAATGAATGG + Intronic
1195956000 X:110331237-110331259 ACAGATGTTGAGTAAATTGATGG - Intronic
1196000440 X:110778613-110778635 CAAGTTATGGAGAAAAGGGAAGG + Intronic
1198313313 X:135441179-135441201 GCAGATATTGACAGAATTGAAGG + Intergenic
1199892491 X:152100420-152100442 ACACATATTGTGAAAATAGAAGG + Intergenic
1200468772 Y:3556411-3556433 CCAGATATTTAGGAATTTGAAGG + Intergenic