ID: 1081501864

View in Genome Browser
Species Human (GRCh38)
Location 11:43674905-43674927
Sequence ATAATAGGACATAAGGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081501864_1081501867 22 Left 1081501864 11:43674905-43674927 CCTCTTTCCTTATGTCCTATTAT 0: 1
1: 0
2: 3
3: 30
4: 309
Right 1081501867 11:43674950-43674972 ATTTTTATCATATAATTAGTTGG 0: 1
1: 0
2: 6
3: 61
4: 547

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081501864 Original CRISPR ATAATAGGACATAAGGAAAG AGG (reversed) Intronic
901988680 1:13095062-13095084 AAAAAAGGAAATAAGAAAAGAGG + Intergenic
901993133 1:13131705-13131727 AAAAAAGGAAATAAGAAAAGAGG - Intergenic
905609549 1:39338226-39338248 ATACTAAGACATCAGGAAAAAGG + Intronic
908648522 1:66306420-66306442 ATAATAAGACAAAAGGAAAGAGG + Intronic
909620390 1:77660746-77660768 ATAATAGGATAGAAGTAATGTGG - Intronic
909832342 1:80208585-80208607 GTTATAGGACAAAAGGAAAAGGG - Intergenic
909869905 1:80726348-80726370 ATAAGAGAACAGAAGGAAAAGGG - Intergenic
910387550 1:86702155-86702177 ATAAGAGGAAATAATCAAAGGGG + Intergenic
910919802 1:92331623-92331645 ATAACAGAACATAAGTCAAGAGG - Intronic
911946701 1:104118889-104118911 ATAAGAAGAGATAAGGACAGAGG + Intergenic
912227677 1:107753942-107753964 ATAATAGGAGATTAGGAAAAGGG + Intronic
913309333 1:117472187-117472209 ATAAGAGGACATAGAGAAGGCGG - Intronic
913519824 1:119634205-119634227 ATCATAGCAAATAAGGAGAGAGG + Intronic
914213109 1:145599719-145599741 ATAATAGCTCAAAAGGAAAAGGG + Intergenic
914671906 1:149877253-149877275 ATAATACTAAATAAGGAAAAGGG + Intronic
916664331 1:166951906-166951928 ATAAGAGGATATGAGGGAAGGGG - Intronic
916965012 1:169929326-169929348 AAAATAGATCATAAGAAAAGAGG + Intronic
917769999 1:178267304-178267326 ATAATAGGAAATCAGTAAAAAGG - Intronic
918455750 1:184711793-184711815 ACAATGGGTCATTAGGAAAGAGG + Exonic
920700625 1:208215710-208215732 ATAAAAGGAGGGAAGGAAAGGGG + Intronic
921171543 1:212554372-212554394 TAATTAGGACATAAGGAAACAGG - Intergenic
924498457 1:244613013-244613035 ACATTAGGAAATAAGGAAATAGG + Intronic
924668679 1:246100669-246100691 ATAAAAGTGCAAAAGGAAAGAGG - Intronic
924853506 1:247854367-247854389 ATCATAGGAGCTAATGAAAGAGG - Intergenic
1063019671 10:2114954-2114976 ATAATAAGAAATAAAGAAATCGG + Intergenic
1063061333 10:2557376-2557398 AGAATAAGAGAGAAGGAAAGAGG - Intergenic
1063991879 10:11575081-11575103 ATAATAGGGAATTAGGAGAGTGG - Intronic
1064464893 10:15569103-15569125 TTAAGAACACATAAGGAAAGGGG + Intronic
1064729738 10:18317969-18317991 ATAATAGGACACAAACAAATGGG + Intronic
1064908440 10:20372871-20372893 ATTAAAGGACAAAAGGAAGGTGG - Intergenic
1065821440 10:29529315-29529337 AAAATAGCACAGGAGGAAAGGGG + Intronic
1068023657 10:51616614-51616636 ATATTCTGGCATAAGGAAAGGGG + Intronic
1068038091 10:51786359-51786381 ATAAAAGGAAATAAGGAAATAGG + Intronic
1068467637 10:57415835-57415857 GTGATAGGAAACAAGGAAAGAGG - Intergenic
1068627152 10:59262058-59262080 TTAATAAGACATAAGGAAAGGGG + Intronic
1069025919 10:63541492-63541514 ATATTAGGACAAAAACAAAGTGG + Intronic
1070068646 10:73063951-73063973 AGAAAATGAAATAAGGAAAGTGG + Intronic
1072563798 10:96600787-96600809 TTAATGGGGCATAAGGAAGGAGG - Intronic
1073095930 10:100979823-100979845 AGAATGGGACATAGGGCAAGGGG - Intronic
1073774013 10:106766178-106766200 TTAAGAGGAGAGAAGGAAAGAGG - Intronic
1074835805 10:117291963-117291985 AGAATAGGACTTAAGAAATGTGG - Intronic
1075720156 10:124580218-124580240 ATAAGAGGCCATAAACAAAGTGG - Intronic
1077848751 11:6053685-6053707 AGAAGAGGAGAAAAGGAAAGAGG + Intergenic
1078410642 11:11114085-11114107 ATAATAGTACATAAGAAAGGAGG - Intergenic
1078738826 11:14047679-14047701 ATAAAAGGACAGAAGGGAAGAGG + Intronic
1078811191 11:14765644-14765666 ATATTAGCACAGAAGGAAAGAGG + Intronic
1080193572 11:29580577-29580599 ATAATAGAAAATATGGAAACAGG + Intergenic
1080232835 11:30037116-30037138 ATAGTAGAATATAAGGAAAAGGG - Intergenic
1080295392 11:30721246-30721268 ATAATTGGAGACAAGGAAAGTGG + Intergenic
1080412651 11:32040437-32040459 AGAATAGGACACAAAGGAAGTGG - Intronic
1080975948 11:37340656-37340678 ACAGTGGGACATAAGGAAAGAGG - Intergenic
1081501864 11:43674905-43674927 ATAATAGGACATAAGGAAAGAGG - Intronic
1081615297 11:44587292-44587314 ATACCAGGACAACAGGAAAGAGG + Intronic
1081656915 11:44863434-44863456 AGAAGAGGACAAAAGGAAAAGGG - Intronic
1083433309 11:62626204-62626226 ATAACAGAACAGAAGGAAGGAGG + Intronic
1085191539 11:74629515-74629537 AAAATAACACAGAAGGAAAGAGG + Intronic
1086117037 11:83263680-83263702 AAAATTGGAACTAAGGAAAGAGG + Intronic
1086140249 11:83490827-83490849 ATTAAAGGAGATAAGGAAATAGG + Intronic
1087957574 11:104307719-104307741 ATGATAGGAAATAAGATAAGTGG + Intergenic
1088119192 11:106348061-106348083 ATCAAAGGACATAAGGCAGGAGG - Intergenic
1088341239 11:108770397-108770419 ATAATAGTACAAAAAAAAAGTGG - Intronic
1088575566 11:111267805-111267827 ATAACAGCTGATAAGGAAAGGGG + Intronic
1089920869 11:122208310-122208332 ATAATAGAAAATAAACAAAGAGG - Intergenic
1093155960 12:15685585-15685607 ATAAGAGAACATTAGAAAAGGGG + Intronic
1094153802 12:27315940-27315962 TTAACAGGACAAAGGGAAAGAGG - Intronic
1094356396 12:29582649-29582671 CTAATATCACTTAAGGAAAGGGG - Intronic
1095375311 12:41520270-41520292 ATAATGGCACATAAGGCAAATGG - Intronic
1095407867 12:41887886-41887908 GTACAAGGATATAAGGAAAGAGG - Intergenic
1095786875 12:46119576-46119598 AGAATAGAACATAGGAAAAGGGG + Intergenic
1096019850 12:48314517-48314539 ATTTCAGGACATAAGGAAAATGG - Intergenic
1096275481 12:50203764-50203786 AGAATAGTAGATAAGGAAAAGGG - Intronic
1097560014 12:61191273-61191295 TTCATAGGACACAAGTAAAGGGG + Intergenic
1097618625 12:61913432-61913454 TTAATAACACAGAAGGAAAGTGG + Intronic
1100310440 12:93390152-93390174 ATAATGGGACATAACGCAGGTGG - Intronic
1102128778 12:110508355-110508377 CTAGTTGGAGATAAGGAAAGAGG - Intronic
1104141226 12:125987904-125987926 ACAATAAGAGCTAAGGAAAGGGG + Intergenic
1106610224 13:31272193-31272215 AAAATAGAAAATAAGGAGAGGGG - Intronic
1106807466 13:33325527-33325549 ATAATAGGACCAAAGGGAAGGGG - Intronic
1107080335 13:36367563-36367585 TTAATAGGCAAGAAGGAAAGGGG - Intronic
1107694295 13:42985547-42985569 ATGAAAGGACCGAAGGAAAGAGG + Intronic
1108138725 13:47394873-47394895 ATAACAGGACATACAGAAGGTGG - Intergenic
1110212963 13:72994297-72994319 ATATTAGGTAATAAGGAAAAAGG + Intronic
1111538203 13:89632341-89632363 ATAATAGGACATAATCATGGAGG - Intergenic
1111761669 13:92474172-92474194 ATAATTTGACAAAAGGACAGAGG - Intronic
1111887638 13:94042545-94042567 GTCATAAGAGATAAGGAAAGTGG - Intronic
1114716609 14:24832834-24832856 ATAATAGTACAAATGGAAATGGG - Intronic
1115160225 14:30385402-30385424 ATAATAGGACATATTTATAGTGG - Intergenic
1120228491 14:81817828-81817850 ACAATAGGACATAAAGACATTGG - Intergenic
1120727217 14:87958228-87958250 ATAATAGAACAAAAGGAGAAAGG + Intronic
1121017075 14:90555391-90555413 ATAAGAGGACCTAGGGAAGGGGG + Intronic
1121887676 14:97559588-97559610 AGAATAGAATATAAGGAAAAAGG + Intergenic
1124147932 15:27146639-27146661 ATAATAGCACAAAAGTGAAGAGG + Intronic
1125705660 15:41733295-41733317 AAAATTGGAACTAAGGAAAGAGG + Intronic
1126398112 15:48240941-48240963 ATAAGCAGACATAAAGAAAGAGG - Intronic
1127168699 15:56275619-56275641 ATAATAGCACAAAGGGCAAGAGG - Intronic
1128590468 15:68891727-68891749 ATAATATTACATAATGATAGAGG - Intronic
1128896199 15:71376324-71376346 AAACTAGGGCATAAGGAAGGAGG - Intronic
1130009060 15:80133720-80133742 ATACTAGGACTTAAGGCAGGAGG + Intronic
1130056913 15:80533889-80533911 AAAAGAGGACATCAGGAAAATGG - Intronic
1130983668 15:88830296-88830318 ATAATAGTAAATAAAGAAACGGG - Intronic
1131619917 15:94057333-94057355 AGAATTGGACAGAAGGTAAGAGG + Intergenic
1134395212 16:13856197-13856219 ATAATAGGAAATACACAAAGAGG + Intergenic
1137297518 16:47110201-47110223 ATAATAGGACATCCGGGAATAGG - Intronic
1138898589 16:61240916-61240938 ATCATAGCACATAAGGAAGCAGG - Intergenic
1140185529 16:72766754-72766776 ATAATGGGCCTTTAGGAAAGGGG + Intergenic
1140258985 16:73361003-73361025 ATAAAAGCAAATAAGGAAATGGG + Intergenic
1141442107 16:84036259-84036281 AAAATAGGACATATGAAAATTGG + Intronic
1144376514 17:14647721-14647743 AAAAGAGGAGAGAAGGAAAGGGG - Intergenic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1146664597 17:34689790-34689812 GTTATTGGACATAATGAAAGTGG - Intergenic
1147013546 17:37471911-37471933 AAAATAGGACATACTCAAAGAGG - Intronic
1149526734 17:57362039-57362061 ATAATTGGCTATTAGGAAAGGGG + Intronic
1150357488 17:64499315-64499337 ATACTAGCAAATAAGGAAAAAGG + Intergenic
1150444559 17:65218659-65218681 AGAAGAGGACAGAAAGAAAGGGG - Intronic
1150957724 17:69879429-69879451 ATAATAAGACATACTAAAAGGGG + Intergenic
1151101094 17:71556115-71556137 AAACTAGGACATGGGGAAAGTGG - Intergenic
1151240276 17:72752047-72752069 ATAATATGACATAAGAAAGAGGG - Intronic
1152496324 17:80675237-80675259 TTAAAAGGACATTAGGAAACAGG - Intronic
1153910480 18:9702128-9702150 AAAATAGGAAATAAGAAAAGAGG - Intergenic
1153977508 18:10282439-10282461 CTGAGAGGACAGAAGGAAAGAGG + Intergenic
1154233665 18:12582232-12582254 ATAATTGGAAATAACCAAAGGGG - Intronic
1155881517 18:31155020-31155042 AGAATAGGAGAGTAGGAAAGAGG - Intronic
1156563785 18:38160266-38160288 AGAAGAGGCCATAAGGAAAGGGG + Intergenic
1156925697 18:42575236-42575258 GAAATAGGACAAAATGAAAGTGG + Intergenic
1157405878 18:47422442-47422464 ATAAAAGTACAGGAGGAAAGTGG + Intergenic
1159395579 18:67851471-67851493 TTTATATGGCATAAGGAAAGAGG - Intergenic
1160456832 18:79007479-79007501 ATAAAAGGACATAAGGACACTGG - Intergenic
1163128260 19:15256149-15256171 AGAAAAGCACAAAAGGAAAGAGG - Exonic
1163879876 19:19909653-19909675 ATAATAGAACAGAAAGAAAATGG - Intronic
1163896079 19:20060704-20060726 ATAATAGAACAGAAAGAAAATGG + Intergenic
1163932981 19:20415982-20416004 ATAATAGAACAGAAAGAAAATGG + Intergenic
1164218071 19:23168534-23168556 GTAATAGAACACAAGGCAAGTGG - Intergenic
1164727724 19:30477758-30477780 ATAAAAGGACTTAAGTGAAGTGG + Intronic
1164765580 19:30764359-30764381 ATAATAAGACATAAGAAGAAAGG - Intergenic
926095118 2:10076418-10076440 AGAATAGGACACAAGGAGGGCGG - Intronic
926411956 2:12613797-12613819 AAAATAGGACAGACAGAAAGGGG - Intergenic
926771414 2:16379567-16379589 ATAAATGGACAGAATGAAAGAGG + Intergenic
926800059 2:16652436-16652458 ATAATAGGGTATACGGCAAGGGG - Intronic
927526709 2:23749380-23749402 ACAATAGGAAATAAGAACAGAGG + Exonic
927537251 2:23873212-23873234 ATAATAGCACAGAAGGAAGTTGG + Intronic
928233901 2:29523347-29523369 TTATGAGGCCATAAGGAAAGGGG - Intronic
928728492 2:34203608-34203630 AAAATAGGAGAGAAAGAAAGTGG - Intergenic
929376817 2:41297525-41297547 ATAATAGCATGTAAGAAAAGTGG - Intergenic
930272357 2:49271534-49271556 ATAATAGGACTTAGGAAAGGAGG + Intergenic
930926901 2:56829484-56829506 AGAAAAGGACATAAAGAAATGGG - Intergenic
932292953 2:70597841-70597863 ATAACAGGACAGAAGGAGAGAGG - Intergenic
933236686 2:79871984-79872006 ACAGTAGAACAGAAGGAAAGGGG + Intronic
933940598 2:87241808-87241830 AAACTTGGAAATAAGGAAAGAGG + Intergenic
934727848 2:96636656-96636678 ATAGTAGGACGTGTGGAAAGGGG - Intronic
935604128 2:104953049-104953071 ATAATAGAACAAAAAGAGAGGGG + Intergenic
936352538 2:111723968-111723990 AAACTTGGAAATAAGGAAAGAGG - Intergenic
937653826 2:124351594-124351616 ATAGTAGCACAAAAGGAACGAGG + Intronic
938581705 2:132652323-132652345 AAAAGACGACAGAAGGAAAGGGG + Intronic
939047968 2:137271988-137272010 ATAATTGGAATTTAGGAAAGAGG - Intronic
939243107 2:139587748-139587770 AAAATAGAATATAAGTAAAGAGG - Intergenic
939794831 2:146630138-146630160 ATAATAGTCAATAAGGAAAATGG - Intergenic
940571278 2:155437925-155437947 ATAATAAGGAATAAGGAAACTGG - Intergenic
940571288 2:155438007-155438029 ATAATAAGGAATAAGGAAACTGG - Intergenic
941265103 2:163351523-163351545 ATAAAAGGAAATAATGAAAGAGG - Intergenic
941347826 2:164391701-164391723 AGAAGAGGAGAAAAGGAAAGAGG + Intergenic
941663096 2:168215729-168215751 ATAATCAGACAAGAGGAAAGGGG + Intronic
942017076 2:171828365-171828387 AGAATTTGACATAAGAAAAGAGG - Intronic
943581097 2:189684552-189684574 ATAATAGAATATAAGGGAATTGG + Intronic
944013125 2:194998941-194998963 TTCATAGGATATAAAGAAAGGGG - Intergenic
944227742 2:197364935-197364957 ATAAGAGGACATATTCAAAGAGG - Intergenic
945798255 2:214391540-214391562 ATAATAGTAAAGAAGGAAATGGG + Intronic
946482884 2:220073794-220073816 ATAATAGCACAGATGGAAAGGGG + Intergenic
946810089 2:223514509-223514531 AGAATAGGACAGAGAGAAAGGGG + Intergenic
947431616 2:230033475-230033497 ATAAAAGGAAATAACGAGAGAGG + Intergenic
948096729 2:235341216-235341238 AAAATAGGGGATTAGGAAAGAGG - Intergenic
1169542452 20:6614769-6614791 ATAATAGGACATCAAAAAAGAGG + Intergenic
1171383686 20:24752792-24752814 ACAAGAGGACATCAGGCAAGGGG - Intergenic
1173309473 20:41884244-41884266 ATAATAGGAGATGAGGCCAGTGG - Intergenic
1173508973 20:43611189-43611211 ATAACAGGAAATAAGGATAAAGG - Intronic
1174501452 20:50988154-50988176 TTTATATGACAGAAGGAAAGAGG - Intergenic
1175640262 20:60623599-60623621 CTAATAGGACTTAAGGGAAAGGG + Intergenic
1175686912 20:61037807-61037829 GTAAGAGGAAATAAGGAAATAGG + Intergenic
1177201277 21:17959061-17959083 CTAAAAGGAAATAAGGAAAAAGG + Intronic
1178262363 21:31111664-31111686 ATAATAGGATATTAGAAAATGGG - Intergenic
1178817164 21:35942053-35942075 AGAAAAGGCCAGAAGGAAAGAGG - Intronic
1180128267 21:45806493-45806515 AAAATACGAGATAAGAAAAGGGG - Intronic
1180175879 21:46088690-46088712 AAAATAGGTCAAAAGGAAATGGG + Intergenic
1181126482 22:20704915-20704937 ATAATCAAACAGAAGGAAAGGGG - Intergenic
1181975318 22:26724734-26724756 ATGATAGGGCACAAGGACAGTGG - Intergenic
1183240050 22:36651050-36651072 AGAAAAAGACATCAGGAAAGTGG - Intronic
1185205281 22:49534280-49534302 ATAAGAGGACTTAACAAAAGAGG - Intronic
950091009 3:10294423-10294445 AGAAGAGGACACAAGGAAAGGGG - Intronic
951130967 3:19044615-19044637 ATATTAGGAGACGAGGAAAGTGG + Intergenic
957584835 3:82120375-82120397 ATAATAGCACATGGGGAAATTGG + Intergenic
958712109 3:97729679-97729701 AAAATAAGGCAGAAGGAAAGTGG - Intronic
958936364 3:100260499-100260521 AGAGTGGGACGTAAGGAAAGGGG - Intergenic
959529551 3:107417416-107417438 AGAAAAAGACATAAAGAAAGGGG + Intergenic
962733805 3:138306349-138306371 AAAAGAGGACACAAGGACAGTGG + Intronic
963127501 3:141828885-141828907 ATAAGAGAACAAAAGGAGAGAGG - Intergenic
963769787 3:149378431-149378453 AGAATGGGAGAGAAGGAAAGAGG + Intergenic
963839361 3:150090008-150090030 ATAATAAGAGAAAAGGAAAAGGG - Intergenic
964557505 3:157955780-157955802 AAAATAGTACAAAAGGTAAGTGG - Intergenic
965858221 3:173114754-173114776 ATGTTAGGACTTAAGGAAAAGGG + Intronic
965994386 3:174862161-174862183 ATAATATGGCATAAGGAATAGGG + Intronic
967319673 3:188183261-188183283 CAAAGAGGACATAAGGAAGGTGG - Intronic
967657092 3:192063511-192063533 AAAAGAGGAAATAAGGAAAAAGG + Intergenic
969245461 4:5929553-5929575 ACAAAAGGACAGAAGGAAAGGGG + Intronic
970062099 4:12046084-12046106 ATAAAAGCACATAATGAAAAAGG - Intergenic
971934954 4:33135943-33135965 ATAAGAGGATCTCAGGAAAGGGG + Intergenic
972439364 4:39070803-39070825 ATAATAAGAGCTAAGGAAAATGG - Intronic
973398781 4:49619835-49619857 TGAATGGGTCATAAGGAAAGTGG + Intergenic
973886141 4:55324115-55324137 CTAATAGAACAGAAGGACAGAGG + Intergenic
974842405 4:67312993-67313015 ATAATAGCACATGAGGTCAGAGG + Intergenic
976005168 4:80421061-80421083 ATATGAGGAGATAAGGAAAGAGG - Intronic
976311756 4:83620242-83620264 CTAATAGGACACAATGAAAAGGG - Intergenic
976621996 4:87137815-87137837 ATGATAGGACAAAAGGGGAGGGG - Exonic
976762913 4:88569395-88569417 TTAACAGCATATAAGGAAAGAGG - Intronic
977128700 4:93205041-93205063 AAACTAAGATATAAGGAAAGTGG - Intronic
977423070 4:96828253-96828275 ATAATATGAAACCAGGAAAGGGG - Intergenic
977617616 4:99103882-99103904 TGAATAGGACATGAGGAAATTGG - Intergenic
978231942 4:106410359-106410381 AGAATAGGACATAAGATAACGGG - Intergenic
978350890 4:107819594-107819616 TGTAAAGGACATAAGGAAAGAGG - Intergenic
978880448 4:113695918-113695940 GTAATAGAAGATAAGGTAAGGGG - Intronic
979314805 4:119249642-119249664 AAAATAGGACATAAATAAACAGG - Intronic
979975396 4:127189999-127190021 ATAAAAGAATAAAAGGAAAGGGG - Intergenic
980502067 4:133668895-133668917 ATGATAGGTAAAAAGGAAAGAGG - Intergenic
980963340 4:139498127-139498149 ATAATAGGAAGTAAGGAATCAGG - Intronic
981307160 4:143259021-143259043 CTAATAGAACATAAGGAAAAAGG + Intergenic
982605148 4:157506539-157506561 AAAATAAGACAGAAAGAAAGAGG - Intergenic
983510901 4:168608815-168608837 ATAATAGAAGATGAGGAAGGCGG + Intronic
983996684 4:174190680-174190702 ATAATAGGAGATAAAGATACTGG + Intergenic
984058366 4:174958427-174958449 ACAAGAAGACATCAGGAAAGGGG - Intronic
984517537 4:180759145-180759167 GTAATGGGTCATAAGGAAAATGG + Intergenic
984572240 4:181408170-181408192 ATAATAGGTCATGAGGGAATTGG + Intergenic
986816778 5:11421204-11421226 ATAAAAGGACAAAAGGAAAGTGG + Intronic
987114978 5:14719002-14719024 ATAATAGGAGTTCTGGAAAGAGG + Intronic
987485191 5:18517459-18517481 ATAATACAACATGATGAAAGTGG + Intergenic
988298835 5:29396019-29396041 TTAATAGGTCATAAAGGAAGAGG - Intergenic
990204284 5:53412462-53412484 ATAAAAGTACATCAGGAGAGGGG - Intergenic
990536677 5:56730170-56730192 ATAATAAATAATAAGGAAAGAGG + Intergenic
990799467 5:59584149-59584171 ACAGTAGGACAAAGGGAAAGAGG + Intronic
991152799 5:63390977-63390999 TTAATAGGAAAAAAAGAAAGTGG - Intergenic
992156348 5:73958735-73958757 AAAATGTGCCATAAGGAAAGAGG - Intergenic
992412103 5:76515556-76515578 AGAATATGACTTAAGGACAGAGG + Intronic
992826806 5:80557579-80557601 ATAATTTGATATAAGTAAAGAGG + Exonic
993018289 5:82562161-82562183 ATAAGAGGTGATAAGGACAGAGG - Intergenic
993375004 5:87140508-87140530 ATAAAAGGGCAGTAGGAAAGAGG + Intergenic
993563298 5:89439594-89439616 AGAATACCACATAAGTAAAGTGG - Intergenic
993865788 5:93193466-93193488 ATAAAAGCCCATAAGGAAAAGGG + Intergenic
995170874 5:109110293-109110315 ATAATAGGACAAAAGAGAAAGGG + Intronic
995862313 5:116653917-116653939 AAAATAGAACTAAAGGAAAGGGG + Intergenic
996979061 5:129468002-129468024 ATAAGAGGACGTAAAAAAAGGGG - Intronic
997634106 5:135391844-135391866 AGAATAGGTCAGAAGTAAAGAGG - Intronic
997636757 5:135414803-135414825 ATTATAGAGCATCAGGAAAGTGG - Intergenic
998447136 5:142206913-142206935 ATAATAAGAGAGAAGGAAGGTGG - Intergenic
998659585 5:144221132-144221154 ATAATACCACATATGTAAAGTGG + Intronic
998759314 5:145414457-145414479 ATAATAATAAATAAGTAAAGAGG - Intergenic
1000122704 5:158212516-158212538 CTTATAGACCATAAGGAAAGAGG - Intergenic
1000321393 5:160137410-160137432 ATAATAGTACATAATAACAGGGG - Intergenic
1000403032 5:160852628-160852650 ATTATACAAAATAAGGAAAGTGG + Intergenic
1000868215 5:166541034-166541056 ATAAAAGGAAGGAAGGAAAGAGG - Intergenic
1005025960 6:21463356-21463378 ATAATAAAACAAAAGGAAACAGG + Intergenic
1007106685 6:39288241-39288263 AAAAAACGAAATAAGGAAAGAGG + Intergenic
1008765408 6:54906990-54907012 ATAATAGAACAAATGGAAATGGG - Intronic
1009409128 6:63345532-63345554 GTAATAAGACATAAAGAAAAGGG - Intergenic
1009928868 6:70152585-70152607 ATAAGATGATATAAGTAAAGTGG - Intronic
1010380249 6:75215769-75215791 ATAATAGGATAGAAGGAACCTGG - Intergenic
1011703361 6:89976324-89976346 ATAATAGGATAGAAGGCAAGCGG - Intronic
1011852465 6:91647210-91647232 ACAAAAGGACAAAAGGAAAATGG - Intergenic
1014509657 6:122305446-122305468 ATAATAGAAGATCAGGATAGGGG + Intergenic
1014888151 6:126807736-126807758 AAAACAGGACATGAGGAAAAGGG - Intergenic
1014937615 6:127402550-127402572 GTAGTAGCACATAAGGAAAGAGG + Intergenic
1015177498 6:130326469-130326491 ACAATAGGACAAAAGAAAGGGGG - Intronic
1015449379 6:133347530-133347552 TTAATAGGAAATACGGAAAAGGG + Intronic
1016335411 6:142999677-142999699 ATTATAAGAGAAAAGGAAAGAGG - Intergenic
1018116581 6:160591843-160591865 CAAATAAGACACAAGGAAAGGGG - Intronic
1018796799 6:167192067-167192089 ATATTAGGACAAAAAGAAAAAGG - Intronic
1018819522 6:167363044-167363066 ATATTAGGACAAAAAGAAAAAGG + Intronic
1021176666 7:17457839-17457861 AGAACAGGGCATATGGAAAGGGG + Intergenic
1022479220 7:30732303-30732325 AGAAAAGGAAAGAAGGAAAGAGG - Intronic
1023210505 7:37798941-37798963 CCAATAGAACACAAGGAAAGTGG + Intronic
1026398667 7:69986061-69986083 AGAGTAAGACATAAGTAAAGCGG - Intronic
1027958388 7:84912233-84912255 ATAATAGTTCATAAGAAAAAGGG + Intergenic
1028401426 7:90429858-90429880 ATAAGAAGACATTAGGAAAATGG + Intronic
1028859626 7:95634185-95634207 CTAAAAGGATTTAAGGAAAGTGG - Intergenic
1028866193 7:95716464-95716486 ATACTTGGAGATAAGGAAACTGG + Intergenic
1030021493 7:105279399-105279421 ATACTAGTTCAAAAGGAAAGGGG + Intronic
1030253379 7:107477000-107477022 AAAATAAGACAGAAGGAAATTGG - Intronic
1030808782 7:113949537-113949559 ATAACTAGACATAAGAAAAGAGG + Intronic
1030892942 7:115023239-115023261 TTAATAGGACCTATGGAAAGGGG + Intergenic
1031108482 7:117575756-117575778 ATAAAAGGAAATAAGGAGAGAGG - Intronic
1032479426 7:132234676-132234698 ATAGTATGACTTAAGGAAATGGG - Intronic
1034208018 7:149335080-149335102 ATAATAGGACATAGTAATAGCGG + Intergenic
1034601938 7:152267007-152267029 ATGATAGAAACTAAGGAAAGGGG - Intronic
1034819500 7:154203696-154203718 ATAATAAGACACCTGGAAAGAGG + Intronic
1036563123 8:9914202-9914224 AGAACAGCACATAAGGAAATGGG + Intergenic
1036986227 8:13534071-13534093 AGAATATGACATAAAGAAAGGGG - Intergenic
1037031038 8:14106066-14106088 TGAATGGGATATAAGGAAAGTGG - Intronic
1040624201 8:49127011-49127033 ATAATAAAACATAAAGAAATTGG - Intergenic
1041213800 8:55579684-55579706 ATATTGGGACAAAAGGAAACGGG - Intergenic
1041333011 8:56748715-56748737 AATATAGGACATAAGAACAGTGG + Intergenic
1043292287 8:78617905-78617927 TTAATATGACATAATGAAAATGG - Intergenic
1043838580 8:85074353-85074375 ATAATATGACATAAGGAGTGTGG + Intergenic
1046014137 8:108585859-108585881 ATAATAGGTACTCAGGAAAGGGG - Intergenic
1046318494 8:112538688-112538710 ACAATAGGACACAAGAAAAATGG + Intronic
1046356843 8:113097541-113097563 ATAATTGGATATATAGAAAGAGG - Intronic
1046965517 8:120161102-120161124 ATAAACGCACATAAGGAAATGGG + Intronic
1048161874 8:132028836-132028858 AGAAAAGGAAAGAAGGAAAGAGG + Intronic
1048161883 8:132028891-132028913 AGAAAAGGAAAGAAGGAAAGAGG + Intronic
1049459222 8:142715504-142715526 ATAATAGGAGAGAAGAAAATTGG + Intergenic
1052201004 9:25780228-25780250 GTCTTAGGACATAAGGCAAGGGG - Intergenic
1053278656 9:36802115-36802137 ATAAAAGGAAAATAGGAAAGGGG + Intergenic
1054776572 9:69128870-69128892 GGAAAAGGACATAGGGAAAGAGG + Intronic
1055244081 9:74219112-74219134 TTAATAGGACAGAAGGAAGATGG - Intergenic
1055744658 9:79429708-79429730 ATAATAGAAAGGAAGGAAAGGGG - Intergenic
1055857089 9:80702005-80702027 ATAATAGGACAATGGCAAAGAGG - Intergenic
1055977289 9:81967757-81967779 ATACTGTGAGATAAGGAAAGCGG + Intergenic
1056530584 9:87483518-87483540 TTAATAGGATATTAGGCAAGGGG - Intergenic
1056912895 9:90719339-90719361 TTAAAAGGACAAAAGGAGAGTGG - Intergenic
1058920318 9:109608277-109608299 ATAATAGGAAAAAAGGGAGGAGG - Intergenic
1059189144 9:112307067-112307089 AAAATAACACATAAGTAAAGGGG + Intronic
1059660591 9:116396513-116396535 ATCACAGGACATAGGGAATGGGG - Exonic
1060543155 9:124445240-124445262 AGAAAAGGAAAAAAGGAAAGAGG + Intergenic
1061101507 9:128495964-128495986 ACAACAGGTCATAGGGAAAGGGG + Intronic
1061703199 9:132432192-132432214 ATAAAAGGACATCAGGAAGCAGG + Intronic
1186428220 X:9482199-9482221 CTTATAGGACCTCAGGAAAGAGG - Intronic
1187079623 X:15973131-15973153 ATAATGTGAGAGAAGGAAAGGGG - Intergenic
1187542959 X:20216565-20216587 AGAATAGCAGATATGGAAAGGGG + Intronic
1188309532 X:28599557-28599579 GTAATAGGACTGAAGGACAGTGG - Intronic
1190214803 X:48472818-48472840 ATAATACGACATTAGATAAGTGG - Intergenic
1190575271 X:51830533-51830555 TTTATAGGAGATGAGGAAAGAGG + Intronic
1192057559 X:67787653-67787675 ATTTTAGGACATCATGAAAGAGG + Intergenic
1192163208 X:68804058-68804080 ATTATAGGAGTGAAGGAAAGGGG + Intergenic
1192416372 X:70984735-70984757 ATAATTAAACATAAGGAAACAGG + Intergenic
1193848669 X:86507760-86507782 AAAATATGACATAATGAAAGGGG + Intronic
1194743073 X:97598301-97598323 ATAATAGGATAGAATGAAATGGG + Intronic
1194850976 X:98868656-98868678 TTATTAGAACATAAGGAAATAGG - Intergenic
1194862408 X:99017039-99017061 ATAAAATGACATAAGTGAAGAGG + Intergenic
1194944020 X:100047136-100047158 TTAATAGAACATAAAGACAGAGG - Intergenic
1196328035 X:114432134-114432156 ATACTAGGAAATAAGGCAAAAGG - Intergenic
1198859994 X:141058507-141058529 AAAAAATGACATAAGGAAAGAGG + Intergenic
1198902699 X:141528883-141528905 AAAAAATGACATAAGGAAAGAGG - Intergenic
1199371516 X:147055503-147055525 AAAAAAGAAAATAAGGAAAGAGG - Intergenic
1199515490 X:148670447-148670469 ATAATAGCATATACAGAAAGGGG + Intronic
1199944338 X:152653352-152653374 ATAAAAGGAACAAAGGAAAGAGG - Exonic
1200871810 Y:8109324-8109346 ATATTAAGACATAAAGACAGGGG + Intergenic
1201327365 Y:12776935-12776957 ATAATAGGTTAAAAGGAAAGTGG + Intronic
1201423680 Y:13826621-13826643 ATAATATGCCCTAAGGAAAGTGG - Intergenic