ID: 1081506301

View in Genome Browser
Species Human (GRCh38)
Location 11:43720732-43720754
Sequence GCACCTAGTAAGTTTAAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081506301 Original CRISPR GCACCTAGTAAGTTTAAACT TGG Intronic
907620528 1:55973613-55973635 TGATCTAGTAAGTTTCAACTGGG - Intergenic
908601387 1:65743963-65743985 GCTGCCAGTAAGTTTGAACTGGG - Intergenic
912346801 1:108970997-108971019 ACACCTGGGAAGTTTAATCTGGG + Exonic
912753808 1:112307883-112307905 GCACTTAGTAAGTATTATCTGGG + Intergenic
913268962 1:117074082-117074104 GCTCCTAGTATGTTAGAACTAGG + Intronic
914794749 1:150910577-150910599 TGACCAAGTAATTTTAAACTAGG - Intergenic
917259746 1:173154209-173154231 GCAGCCAGGAAGTTCAAACTGGG + Intergenic
918501483 1:185201014-185201036 GCCCCCAGGAAGTTTAGACTCGG - Intronic
918705506 1:187656783-187656805 GCACTTAGAAACTATAAACTGGG - Intergenic
921222725 1:212984890-212984912 GCTCCTAGCAAGTTCTAACTCGG - Intronic
924132547 1:240926987-240927009 CTACTTGGTAAGTTTAAACTGGG + Intronic
1068743437 10:60501402-60501424 GCACCTAGAAAATGAAAACTTGG + Intronic
1068951588 10:62782683-62782705 GCCCCTGGGAAGTTTGAACTGGG + Intergenic
1072876198 10:99175497-99175519 GCAGCTAGGAAGTTCCAACTGGG + Intronic
1081227751 11:40545632-40545654 GCACATATTAAGTATAAACAAGG + Intronic
1081506301 11:43720732-43720754 GCACCTAGTAAGTTTAAACTTGG + Intronic
1086800132 11:91163008-91163030 GCACATTGTAGGTTTAAAGTTGG + Intergenic
1091476768 12:782802-782824 GCTACTAGAAAATTTAAACTAGG - Intronic
1094733102 12:33200629-33200651 GCAGCCAGGAAGTTTGAACTTGG - Intergenic
1097635178 12:62113756-62113778 GCCGCCAGGAAGTTTAAACTGGG - Intronic
1097745278 12:63294955-63294977 GCAAGCAGTAAGTTTAAATTTGG + Intergenic
1099797992 12:87422421-87422443 GCCTCTGGTAAGTTCAAACTGGG - Intergenic
1100067156 12:90663284-90663306 GCACAGAGTGAGTTTACACTTGG + Intergenic
1100136291 12:91557158-91557180 GCTCCTGGGAAGTTTGAACTGGG + Intergenic
1101351330 12:103931905-103931927 ACACCGAGTAAGTTTAAAAATGG + Intronic
1101410206 12:104461145-104461167 GCGCCTGATTAGTTTAAACTGGG - Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1110876528 13:80517324-80517346 GCAGCTGGGAAGCTTAAACTGGG + Intergenic
1111985659 13:95064195-95064217 CCACCTATAAAGTATAAACTAGG - Intronic
1113929515 13:113958976-113958998 GCCCCTAGTATCTTTCAACTAGG - Intergenic
1114964382 14:27939422-27939444 GCAGCCAGGAAGTTTGAACTGGG + Intergenic
1116060263 14:39915140-39915162 GCACCTAGAAAGTGAAAATTAGG - Intergenic
1116209199 14:41911257-41911279 GCACCTGGGAAGCTCAAACTGGG - Intergenic
1120065780 14:80039264-80039286 GCAGCTGGGAAGCTTAAACTGGG + Intergenic
1125060388 15:35414008-35414030 GAACTTAGTATGTTTTAACTAGG + Intronic
1126404538 15:48310246-48310268 GAACCTATTAAGATTATACTTGG - Intergenic
1128476174 15:67998576-67998598 GTACCTACTAAGTTCAAATTTGG + Intergenic
1134909828 16:18015218-18015240 GCACCTGCTAAGCTTGAACTTGG + Intergenic
1135352105 16:21737848-21737870 GCACCTACTAAGTGCAGACTGGG + Intronic
1135450595 16:22553971-22553993 GCACCTACTAAGTACAGACTGGG + Intergenic
1138170108 16:54840918-54840940 GCACTCAGTAAATATAAACTGGG - Intergenic
1145264449 17:21372965-21372987 ACTCCTAGAAAGGTTAAACTGGG + Intergenic
1148967399 17:51447349-51447371 GCCGCTAGAAAGTTTGAACTGGG + Intergenic
1150449902 17:65258079-65258101 ACACCTAGTAAGTATTAACATGG + Intergenic
1154041442 18:10859944-10859966 GCAGCTAGGAAGTTTAAAGTGGG + Intronic
1155080542 18:22406205-22406227 GCTGCCAGGAAGTTTAAACTGGG + Intergenic
1155592067 18:27438874-27438896 GCACATAGGAAATTTGAACTTGG - Intergenic
1159684427 18:71400367-71400389 GCACCTTGTTATTATAAACTAGG + Intergenic
1164121747 19:22272012-22272034 CCACCTTGTAAGTGTAAACAAGG - Intergenic
1165371906 19:35413728-35413750 GCACCTAGTTAATATAAGCTAGG + Intergenic
924987163 2:282413-282435 ACACATAGTAAGTATAAAATTGG + Intronic
925385035 2:3456090-3456112 GAATCTAGCCAGTTTAAACTAGG - Intronic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
928522706 2:32106108-32106130 GCAGCTAGGAAGCTTGAACTGGG - Intronic
928700247 2:33891676-33891698 CCACCTAGTACATTTAAATTAGG - Intergenic
930252440 2:49049975-49049997 ACACCTAGCAAGTTAAAAATAGG + Intronic
930516115 2:52409906-52409928 GCCCCCAGGAAGTTCAAACTGGG - Intergenic
936712355 2:115145967-115145989 GTACATAGAAAGTTTTAACTAGG - Intronic
937891730 2:126944279-126944301 TCACCTAGTCAGTTGAAACCAGG - Intergenic
937893318 2:126956974-126956996 GCCCCCAGGAAGTTCAAACTGGG + Intergenic
939589750 2:144049922-144049944 GCACATAGTAAGTTTATAATTGG + Intronic
943561750 2:189472277-189472299 GCAGCTTGTAATTTTAAACAGGG + Intronic
945662459 2:212703044-212703066 GCACATAGAAAATATAAACTTGG + Intergenic
945690072 2:213022754-213022776 GCACCTAGTAGGTTAATTCTTGG - Intronic
1170200270 20:13735511-13735533 GCACCTAAGAAATGTAAACTGGG + Intronic
1175369658 20:58479667-58479689 TCACCTAGAAAGTTTGGACTTGG + Intronic
949641024 3:6036151-6036173 GCAGCCAGGAAGTTTAAAGTGGG - Intergenic
953274902 3:41485259-41485281 TCATCTAGCAAGTTTAAAGTGGG + Intronic
958042386 3:88242902-88242924 GAACCTAGTAAGTATGAAATAGG + Intergenic
959622624 3:108414552-108414574 GAACCTAGTAAGATAACACTAGG + Intronic
960078681 3:113516729-113516751 GCACTTAGTAAGTGTAAAGTAGG - Intergenic
960763298 3:121097093-121097115 GCAGCCAGGAAGTTTGAACTGGG - Intronic
964053315 3:152421539-152421561 GCCGCTGATAAGTTTAAACTGGG + Intronic
966265892 3:178042881-178042903 ACACCTAGTATGTATATACTGGG - Intergenic
971160983 4:24133822-24133844 GCACCTAGCAAATATTAACTGGG - Intergenic
973039643 4:45454291-45454313 GCACTTAGAATGTTTAAAATGGG - Intergenic
973154931 4:46939046-46939068 GCAACAAGTAAGTTTTAAATAGG + Intronic
974280037 4:59780514-59780536 GCAGCCAGGAAGTTTGAACTGGG + Intergenic
974793016 4:66714272-66714294 GCCCCCAGTAAGGTTGAACTGGG + Intergenic
975524268 4:75331677-75331699 GCCACTAGGAAGTTTGAACTGGG + Intergenic
975753573 4:77549996-77550018 GCAGCTAGGAAGCTTGAACTGGG - Intronic
977477996 4:97537538-97537560 GCAGCTGGGAAGTTCAAACTGGG + Intronic
978699752 4:111628216-111628238 GCAACCAGAAAGTTTGAACTGGG - Intergenic
981784343 4:148461084-148461106 GCATCTAGTGAGTTGAAGCTGGG - Intergenic
982909205 4:161118011-161118033 GCCTCCAGGAAGTTTAAACTTGG - Intergenic
983317116 4:166146423-166146445 GCGCCTTGTAAGTAGAAACTTGG - Intergenic
983334510 4:166374925-166374947 GCAGCTGGGAAGTTTGAACTGGG - Intergenic
986920504 5:12674031-12674053 GCAACTGGGAAGTTTGAACTTGG - Intergenic
989087291 5:37689174-37689196 GCAGCTAGGAAGCTTGAACTGGG + Intronic
990069518 5:51763434-51763456 GCACCTACTATGTGTCAACTGGG - Intergenic
990197452 5:53334587-53334609 GCACCTTGCAAGTTTAAACTGGG - Intergenic
991236725 5:64407352-64407374 GCCACTAGGAAGTTCAAACTGGG + Intergenic
994233519 5:97336153-97336175 GCTGCTAGGAAGTTTGAACTGGG - Intergenic
994254096 5:97572131-97572153 AAACCTAGTAACTTAAAACTTGG + Intergenic
996697586 5:126415710-126415732 GAAACTAGTAAGTTGAAACAAGG - Intronic
999489820 5:152039057-152039079 GCAGCCAGGAAGTTTGAACTGGG - Intergenic
999987867 5:157021991-157022013 ACACCTACTAAGTATAAGCTAGG + Intergenic
1005303625 6:24494140-24494162 GCCACTAGTAAGATTAAAGTTGG - Intronic
1012083054 6:94785203-94785225 GCAACCAGGAAGTTCAAACTGGG - Intergenic
1014058476 6:117043855-117043877 GCCCCCAGGAAGTTCAAACTGGG - Intergenic
1015970626 6:138739718-138739740 GCACCAAGGAAGTTTGTACTGGG + Intergenic
1018400880 6:163417793-163417815 GCATATAGTATGTTTAAAATGGG + Intronic
1018978679 6:168584702-168584724 GCTCCTAGTAAGCATAAAATAGG - Intronic
1019818148 7:3216599-3216621 ACAGCTATTAAGTGTAAACTGGG - Intergenic
1020154296 7:5709695-5709717 GCATCTAGTGAGTATCAACTTGG - Intronic
1021347656 7:19548001-19548023 GCCACTGGGAAGTTTAAACTGGG - Intergenic
1024667034 7:51557814-51557836 GCAGCTAGGAAGCTTGAACTGGG - Intergenic
1028067589 7:86406570-86406592 GCAGCTAGTCAGTTTCATCTGGG - Intergenic
1028523650 7:91759461-91759483 GCAACCAGGAAGTTTGAACTGGG + Intronic
1036279546 8:7388562-7388584 ACACCTAGTAAAATAAAACTCGG + Intergenic
1039878578 8:41608783-41608805 GCAGCTAGTGAATGTAAACTTGG + Intronic
1040736386 8:50513563-50513585 GCACCCAGGAAGCTCAAACTGGG - Intronic
1041718019 8:60949844-60949866 GCACCTCTTAATTTGAAACTAGG + Intergenic
1042386507 8:68181495-68181517 GCACTTTGGAAGTTTAAAATAGG + Intronic
1050875331 9:10627498-10627520 TCACCTAATAAATTTGAACTTGG + Intergenic
1052096569 9:24391243-24391265 GCCACTAGGAAGTTTGAACTGGG - Intergenic
1052382323 9:27784969-27784991 GCCTCTAGGAAGTTCAAACTGGG - Intergenic
1052909693 9:33869376-33869398 GCTCCAAGTCAGTTTATACTTGG + Intronic
1054854785 9:69886950-69886972 GCACCTAGTATAGTCAAACTTGG + Intronic
1055338675 9:75259331-75259353 GCAGCCAGGAAGATTAAACTGGG - Intergenic
1058072856 9:100619376-100619398 GCCACTAGGAAGTTCAAACTGGG - Intergenic
1062297623 9:135841226-135841248 GCCGCCAGGAAGTTTAAACTGGG + Intronic
1186168084 X:6848354-6848376 GCAACTAGTAATTTGAAAATAGG + Intergenic
1186956991 X:14694351-14694373 GCACCTACTATGCTTAAACATGG + Intronic
1188543858 X:31280102-31280124 GCACCTAGTCAATTTATCCTTGG + Intronic
1191015403 X:55804669-55804691 GCATCTAGAAAGTGTAAAGTTGG - Intergenic
1192524564 X:71830342-71830364 GCCCCTGGGAAGTTCAAACTGGG + Intergenic
1192694750 X:73401746-73401768 GCCGCTGGGAAGTTTAAACTGGG + Intergenic
1193033526 X:76924838-76924860 GCAGCCAGGAAGCTTAAACTGGG + Intergenic
1193387943 X:80893268-80893290 GCAGCTAGGAAGCTCAAACTGGG - Intergenic
1194964022 X:100267204-100267226 GCCCCTGGAAAGTTCAAACTGGG + Intergenic
1196545708 X:116962340-116962362 GCAGCCAGGAAGTTCAAACTGGG - Intergenic
1197157242 X:123283623-123283645 CCACCTGGGAAGTTCAAACTCGG + Intronic
1200732569 Y:6758398-6758420 GCAGCCAGGAAGTTCAAACTGGG - Intergenic
1201171769 Y:11273646-11273668 GCAGCCAGGAAGTTCAAACTGGG - Intergenic
1201419460 Y:13782471-13782493 GCAGCAAGGAAGTTCAAACTGGG - Intergenic
1201498782 Y:14618773-14618795 TCATCTAGTGAGTTGAAACTGGG + Intronic
1201783350 Y:17746204-17746226 GCACCCAGGAAGCTCAAACTGGG + Intergenic
1201818203 Y:18159783-18159805 GCACCCAGGAAGCTCAAACTGGG - Intergenic
1202174703 Y:22086480-22086502 GCACCCAGGAAGCTAAAACTGGG + Intronic
1202216659 Y:22499902-22499924 GCACCCAGGAAGCTAAAACTGGG - Intronic
1202326528 Y:23696166-23696188 GCACCCAGGAAGCTAAAACTGGG + Intergenic
1202343138 Y:23889940-23889962 GCACCCAGGAAGCTCAAACTAGG + Intergenic
1202527630 Y:25780145-25780167 GCACCCAGGAAGCTCAAACTAGG - Intergenic
1202544242 Y:25973887-25973909 GCACCCAGGAAGCTAAAACTGGG - Intergenic