ID: 1081508594

View in Genome Browser
Species Human (GRCh38)
Location 11:43744366-43744388
Sequence AGCAGGTTACATAGAAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081508591_1081508594 -6 Left 1081508591 11:43744349-43744371 CCAATGATAAAAAAAAAAGCAGG 0: 1
1: 0
2: 6
3: 97
4: 1089
Right 1081508594 11:43744366-43744388 AGCAGGTTACATAGAAATGGTGG 0: 1
1: 0
2: 3
3: 15
4: 172
1081508589_1081508594 -4 Left 1081508589 11:43744347-43744369 CCCCAATGATAAAAAAAAAAGCA 0: 1
1: 0
2: 10
3: 233
4: 2840
Right 1081508594 11:43744366-43744388 AGCAGGTTACATAGAAATGGTGG 0: 1
1: 0
2: 3
3: 15
4: 172
1081508590_1081508594 -5 Left 1081508590 11:43744348-43744370 CCCAATGATAAAAAAAAAAGCAG 0: 1
1: 1
2: 14
3: 176
4: 2137
Right 1081508594 11:43744366-43744388 AGCAGGTTACATAGAAATGGTGG 0: 1
1: 0
2: 3
3: 15
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081508594 Original CRISPR AGCAGGTTACATAGAAATGG TGG Intronic
904235476 1:29113902-29113924 AGCAGGTTTCATAGAGAGGTGGG + Intronic
905877380 1:41441401-41441423 AGCAGGGTAAATAGAAAGAGTGG - Intergenic
913360436 1:117974937-117974959 AGGAGTTTGCATAGAGATGGAGG - Intronic
914935588 1:151976856-151976878 AGCAAATTACATAGAAAATGTGG - Intergenic
914993935 1:152523577-152523599 GGAAGGTTACATAGATATTGAGG - Intronic
916151060 1:161791340-161791362 AGCAAATTGCATAGAAAAGGAGG - Intronic
916282398 1:163066286-163066308 AGCAGCCTAGATAGAACTGGGGG - Intergenic
921845221 1:219871897-219871919 AGCAGGTTACAAAACAATGTGGG + Intronic
1062840482 10:666548-666570 CACAGGTAACATAGAACTGGGGG + Intronic
1065313558 10:24439880-24439902 ATCAGGTTACATGGAAAAGGGGG - Intronic
1065701419 10:28429600-28429622 AGAAGGTTAAAAAGGAATGGTGG - Intergenic
1067471849 10:46543404-46543426 AACAGATTAAAGAGAAATGGGGG + Intergenic
1069549419 10:69352412-69352434 AGCAGGTGTCATAGATTTGGTGG - Intronic
1073846730 10:107564955-107564977 AATAGGTTAGAGAGAAATGGGGG + Intergenic
1075444176 10:122502432-122502454 TGCAATTTACATAGATATGGTGG + Intronic
1079319786 11:19442283-19442305 AGCAGGGGAAATAGGAATGGAGG - Intronic
1079568086 11:21908101-21908123 ATTAGGTTTCATAGAAAAGGTGG + Intergenic
1079928762 11:26530914-26530936 AACAGGATACATAAAGATGGTGG - Intronic
1081508594 11:43744366-43744388 AGCAGGTTACATAGAAATGGTGG + Intronic
1081553852 11:44139601-44139623 AGCTGGCTAGAAAGAAATGGGGG - Intronic
1081988902 11:47327145-47327167 AGCAGGTGACATGGACATAGTGG - Intronic
1084222771 11:67694474-67694496 AGCAGGTTATTAAGAAACGGGGG + Intergenic
1085085983 11:73667086-73667108 ATCAGACTTCATAGAAATGGTGG + Intergenic
1085809775 11:79669558-79669580 AGCAGGTTTCCCAGAAAAGGAGG + Intergenic
1087185864 11:95194272-95194294 CTCAGGTTACCTAGTAATGGGGG - Intronic
1094066656 12:26368825-26368847 TGCAGGTTACATTCAAATGAAGG + Intronic
1094284017 12:28772316-28772338 TTCAGGTCACACAGAAATGGTGG + Intergenic
1095099028 12:38162521-38162543 AGAAGGTGACAGAGAGATGGAGG + Intergenic
1095635468 12:44428341-44428363 AGAAATTTACATGGAAATGGAGG + Intergenic
1097860226 12:64511573-64511595 AGCAGGTTACACAGAAAAGGAGG - Intergenic
1098039499 12:66339807-66339829 ATCAGGTTACCTAGGGATGGGGG - Exonic
1098198864 12:68033749-68033771 AGCAGGAGGCATAGGAATGGTGG + Intergenic
1098287055 12:68917973-68917995 AGCAGGATACAGATATATGGTGG - Intronic
1099224759 12:79956296-79956318 AGAAGGTTGCAAAGAATTGGTGG - Intergenic
1099617395 12:84954327-84954349 AGCATTTTAGATAAAAATGGTGG - Intergenic
1101806948 12:108072468-108072490 AGCAAGTTGCAAAGAAATAGGGG - Intergenic
1107040539 13:35943190-35943212 AGAAGGTTACATGAAGATGGAGG + Intronic
1108477789 13:50838339-50838361 AGCAAGTTTCATGGAAATTGTGG - Intronic
1110593248 13:77288797-77288819 AGAAGTTTACACAGAAATGAGGG + Intronic
1111714291 13:91860362-91860384 AGCAATATGCATAGAAATGGAGG - Intronic
1112367069 13:98764321-98764343 AGCAGGTTACAAAGTATTGTAGG + Intergenic
1113069765 13:106409214-106409236 AGTAGGTTACATGGCAAAGGGGG + Intergenic
1114739863 14:25084641-25084663 AGAAGGTAACATAGAGATGAGGG + Intergenic
1115731608 14:36275016-36275038 AACAGGTGACATACAAATGAAGG + Intergenic
1118481508 14:66171859-66171881 AGAAGGTAACATAGAAATACAGG - Intergenic
1120040629 14:79748923-79748945 AGCAGGCTAAATTGAAAGGGAGG + Intronic
1123206915 14:106722580-106722602 AGCAAGATGCATAGAAGTGGGGG - Intergenic
1123211933 14:106769584-106769606 AGCAAGATGCATAGAAGTGGGGG - Intergenic
1126308089 15:47283931-47283953 AGAAGGTCAAATAGAAATGGAGG - Intronic
1127513146 15:59663966-59663988 AACAGGTTACATAAAAATATGGG + Exonic
1128175734 15:65554127-65554149 TGCAGGGTACATGGAAATGCTGG - Intronic
1128770473 15:70278062-70278084 GCCAGGCTACATAGAAATGAGGG - Intergenic
1131651014 15:94399786-94399808 AGCAGGGAGCAAAGAAATGGTGG - Intronic
1133593304 16:7266862-7266884 AGCAGGTGACTTAGGACTGGGGG + Intronic
1133673374 16:8045855-8045877 AGCAGGATACAAAGAAATACAGG - Intergenic
1134420561 16:14083850-14083872 AACAGGTTACATACAAAAGAAGG - Intronic
1135750769 16:25057135-25057157 AGCAGGGAACAAGGAAATGGGGG + Intergenic
1135877532 16:26217012-26217034 AGCAGGTTACAGGGCAGTGGAGG + Intergenic
1137949415 16:52768981-52769003 AGCATCTTACATAGTGATGGTGG - Intergenic
1139171547 16:64636163-64636185 ACAAGGTTACATAGAAATAATGG + Intergenic
1139845524 16:69918465-69918487 AGCAGTTTACATATTAATGGTGG + Intronic
1144054861 17:11531372-11531394 AGCAGGTTAGCTACAGATGGGGG + Intronic
1146036552 17:29411966-29411988 AGCAAGCTGCATAGATATGGAGG - Intronic
1148512520 17:48184613-48184635 AGCAGGTAACAAAGAAAGGCTGG + Intronic
1149046215 17:52248471-52248493 AGCAGATTACTTAGAAATGTGGG + Intergenic
1152395414 17:80030074-80030096 AGCAGCTGACCTTGAAATGGGGG - Intronic
1152673598 17:81624639-81624661 AGCAGTTTACCAACAAATGGGGG + Intronic
1153983712 18:10334464-10334486 AGAAGGTTGCTTAGAAACGGGGG - Intergenic
1154280008 18:12994284-12994306 AGAAGGTAACATATAAATTGAGG + Intronic
1155797485 18:30058638-30058660 AACAAGTTACATAGAAAAGGAGG + Intergenic
1156677677 18:39550034-39550056 AGAAGATTTCATAGAAATGAAGG - Intergenic
1157021625 18:43789666-43789688 TGCAGGATACAAAGAAATGATGG + Intergenic
1157488137 18:48103934-48103956 TGCAGGTTAGAGGGAAATGGGGG + Intronic
1158669174 18:59459394-59459416 AACAGTTTACTTAGAAATTGGGG + Intronic
1159253864 18:65919894-65919916 AGCAGAGGAAATAGAAATGGAGG + Intergenic
1159833711 18:73310490-73310512 AGCAATTTTCATAAAAATGGTGG + Intergenic
1159914316 18:74175015-74175037 AGCTGGTAACACAGAAATGGGGG + Intergenic
1167360953 19:49030103-49030125 AGCAGGTGACAAAGAAGTGTTGG - Intronic
1167363438 19:49042495-49042517 AGCAGGTGACAAAGAAGTGTTGG - Intergenic
925691539 2:6529096-6529118 AGGAGGTCACATAAAGATGGCGG - Intergenic
927210463 2:20636021-20636043 GGCTGGTTGCATGGAAATGGTGG + Intronic
928213262 2:29339681-29339703 GGCTGGTGACATAGAGATGGAGG + Intronic
931153762 2:59604407-59604429 AGCAGGGTACTTAGCTATGGAGG - Intergenic
931872951 2:66481309-66481331 AGCTGGCTACATAGCAATGGGGG - Intronic
932907882 2:75773574-75773596 ACCAGGTTACACAGTAATGATGG - Intergenic
935998149 2:108796668-108796690 AGCAGCATAGATAGAATTGGAGG + Intronic
939320753 2:140618250-140618272 AGAAGGTTTTATAGAAATGAGGG + Intronic
939792322 2:146593431-146593453 AGCAGATATCATAGAAATGTTGG + Intergenic
940409352 2:153342589-153342611 AACACGTTACAAAGATATGGGGG + Intergenic
940460573 2:153958773-153958795 AGAGGGTTACACAGAAAGGGAGG + Intronic
942442648 2:176052189-176052211 GGCTGGTGTCATAGAAATGGAGG - Intergenic
942484860 2:176428340-176428362 AGCAGGTCGCATAGAACAGGTGG + Intergenic
942948853 2:181700126-181700148 AGTAGTTTACATTAAAATGGGGG + Intergenic
944876924 2:203971908-203971930 AGAAAGTCACATTGAAATGGAGG + Intergenic
947207552 2:227675639-227675661 AGCAGGATATATAGAATCGGTGG + Intergenic
947816725 2:233042341-233042363 AGCAGGTGATACAGAAAAGGTGG - Intergenic
949016938 2:241718859-241718881 AGCTGGTTACCAAGGAATGGTGG - Intronic
1169383515 20:5128163-5128185 AGCAGGTGACAAAGTGATGGTGG - Intronic
1169432587 20:5551992-5552014 AGCAGATTATTTAGAAATAGAGG + Intronic
1171950333 20:31415757-31415779 AATAGGTTTCAGAGAAATGGTGG + Intergenic
1172523410 20:35583521-35583543 AGCAGGTGATGTAGAACTGGAGG - Intergenic
1175672802 20:60920498-60920520 AGCAGGTTAGAAAGCAATGGGGG + Intergenic
1176344266 21:5727444-5727466 GTCAGGTTACCTACAAATGGAGG - Intergenic
1176351080 21:5848028-5848050 GTCAGGTTACCTACAAATGGAGG - Intergenic
1176500561 21:7597012-7597034 GTCAGGTTACCTACAAATGGAGG + Intergenic
1176538587 21:8125513-8125535 GTCAGGTTACCTACAAATGGAGG - Intergenic
1179231519 21:39507789-39507811 AACATGTTTCATAGAGATGGGGG + Intronic
1180113106 21:45674954-45674976 AGCAAGAGAAATAGAAATGGTGG - Intronic
1182269173 22:29142749-29142771 ATCAGGTTTGATATAAATGGGGG - Intronic
1203243533 22_KI270733v1_random:41868-41890 GTCAGGTTACCTACAAATGGAGG - Intergenic
949339667 3:3015623-3015645 AGCAGGTTAAACAGAAAAAGAGG + Intronic
949637397 3:5998060-5998082 AGAAGGTTACATGATAATGGAGG + Intergenic
954630604 3:52045803-52045825 TGCAGGTCTCATAGCAATGGAGG - Intergenic
957892571 3:86379072-86379094 AGCAGGATACATAAAAAGGGAGG - Intergenic
958024351 3:88033200-88033222 AGCAGGAGACAGAGAAGTGGAGG + Intergenic
962068908 3:132012628-132012650 AGCAGGTAAGATGGCAATGGTGG + Intronic
964402498 3:156313948-156313970 AGAAGGCTACATGGAAAAGGGGG - Intronic
968419775 4:474035-474057 CGCAGGTTACAGAGCGATGGAGG + Intronic
969475356 4:7419424-7419446 CTCAGGTTACAGAGAAAGGGTGG + Intronic
970140509 4:12977040-12977062 TACAGGTGACATAGAAATTGAGG - Intergenic
974261914 4:59536198-59536220 TGCAGCTTACAAAGAAATGATGG + Intergenic
974419668 4:61657164-61657186 AGCAAGTTATATAAAAATGATGG - Intronic
975284393 4:72600112-72600134 AGCTGGTGATACAGAAATGGTGG + Intergenic
976844826 4:89475605-89475627 AGCAAGATACTTTGAAATGGAGG + Intergenic
977974561 4:103249161-103249183 AGCAACTTGCATAGAACTGGAGG - Intergenic
979885805 4:126025857-126025879 AGCAGGATAAAGAGAAAAGGTGG - Intergenic
981262330 4:142736293-142736315 AGCAAGTTTCATAGAAATTAGGG - Intronic
981751008 4:148092290-148092312 AGCAGGTTAAAGAGAAAGTGGGG - Intronic
981778424 4:148397172-148397194 AGCAGGTCACGGGGAAATGGTGG - Intronic
981849770 4:149216565-149216587 AGCAGCTCACCTAGAGATGGAGG - Intergenic
982574862 4:157096806-157096828 AACAGGTTACATAGCAGGGGTGG + Intronic
983562154 4:169112063-169112085 AGCTGGGTACAGAGAAAAGGAGG + Intronic
983770594 4:171544481-171544503 AGCAGCATACATAAAATTGGGGG + Intergenic
988177835 5:27750032-27750054 AGCCAGGTACATATAAATGGTGG + Intergenic
989782684 5:45288257-45288279 AGCAATTTAAAAAGAAATGGAGG - Intronic
990037624 5:51341560-51341582 AGCAGCTTACAGTGTAATGGTGG + Intergenic
990682191 5:58257611-58257633 AGCAGATTACGAAGAAAGGGTGG - Intergenic
991293189 5:65053177-65053199 AGCAGGATAGATGGAACTGGGGG - Intergenic
992548864 5:77843040-77843062 AGCAGGATATAAAGAAATGTCGG - Intronic
993377701 5:87169027-87169049 AGAGGGTTCCCTAGAAATGGGGG - Intergenic
993815802 5:92543610-92543632 ATCAGCTTAAAAAGAAATGGGGG - Intergenic
994604053 5:101943968-101943990 AGCATGTTACATGGCAAAGGAGG - Intergenic
996796240 5:127351677-127351699 AGCATGTGACAAAGAGATGGTGG - Intronic
998506097 5:142674097-142674119 AGCAGGTGACATAGAAGTGGTGG - Intronic
999031924 5:148303310-148303332 AGGAGGTAACATGGAAATGGGGG - Intergenic
1000092663 5:157943503-157943525 AGGAGGTTGAAAAGAAATGGTGG + Intergenic
1001902003 5:175439418-175439440 AGCAGGTGACATAGAAATTAAGG - Intergenic
1003771997 6:9315846-9315868 AGCTGCTTACATAAAAATGTTGG - Intergenic
1004218453 6:13724144-13724166 ATCAGGTTTCCTAGAAACGGAGG + Intergenic
1004954309 6:20710952-20710974 AGCATTTTACAAAGAAATGAGGG - Intronic
1006357258 6:33567258-33567280 GGCAGCTTACATAGCCATGGAGG - Intergenic
1009340687 6:62551005-62551027 AACAGGATACAAACAAATGGAGG - Intergenic
1010341071 6:74753507-74753529 ATGAGGTTACAGAGAGATGGGGG - Intergenic
1018046587 6:159970685-159970707 AGTATGATACAGAGAAATGGTGG + Intronic
1018213246 6:161502622-161502644 AGCAGGGAAGAGAGAAATGGGGG + Intronic
1019004200 6:168782657-168782679 AGCAGGTTCCAGGGAAATGGAGG - Intergenic
1023049512 7:36238864-36238886 GGCAGGTGACATAGAAATGCAGG + Intronic
1023855962 7:44184292-44184314 AGCTGATTACAAAGAAATGATGG - Intronic
1026388138 7:69872340-69872362 AGCAAGTTACAGATAAAAGGTGG - Intronic
1027796990 7:82708184-82708206 AGCAGACTACATAGAATTTGAGG + Intergenic
1028778023 7:94702621-94702643 AGCAGGTCACAGAGCGATGGAGG - Intergenic
1028806502 7:95032539-95032561 AGAAGGTTACAGGGAAGTGGGGG - Intronic
1028891149 7:95989739-95989761 AGCAGGTCACACAAAAATAGGGG - Intronic
1028944360 7:96559841-96559863 AGCATGTCACTTATAAATGGAGG + Intronic
1030416003 7:109243574-109243596 AGCAGCATAGATAGAACTGGAGG + Intergenic
1035872000 8:3145428-3145450 ATCAGGGTGCAAAGAAATGGAGG + Intronic
1035893613 8:3372761-3372783 AACAGGTTACATAGGTCTGGAGG + Intronic
1035953352 8:4049080-4049102 AGCAGGATAGAAAAAAATGGAGG - Intronic
1042563564 8:70091609-70091631 GGAAGGTTTTATAGAAATGGTGG - Intergenic
1043510869 8:80949046-80949068 AGCTGGTTACACAAAAATGGAGG - Intergenic
1046647439 8:116801692-116801714 AGGAGGTTACAAAGAAATGTGGG - Intronic
1049280491 8:141741689-141741711 GGCAGGAAACAGAGAAATGGTGG - Intergenic
1050114148 9:2245768-2245790 ATAAGGTTACAAAGAAATGCTGG + Intergenic
1050139326 9:2501315-2501337 AGCAGTTTCCATGTAAATGGTGG - Intergenic
1051408213 9:16761878-16761900 ACCAAGTTACATGTAAATGGTGG + Intronic
1055799999 9:80024432-80024454 AACAGTTCACTTAGAAATGGAGG - Intergenic
1056470770 9:86902959-86902981 TCCAGGGTGCATAGAAATGGGGG - Intergenic
1056711140 9:88992463-88992485 AGAAGGTTACTTTTAAATGGAGG + Exonic
1057114296 9:92506007-92506029 AGGAGTTTCCATAGAAATTGTGG + Intronic
1060023185 9:120149781-120149803 AGCAGGATACATAGAAAAGGTGG + Intergenic
1203459861 Un_GL000220v1:24951-24973 GTCAGGTTACCTACAAATGGAGG - Intergenic
1185523840 X:761632-761654 AGAAGGTCACATGGAGATGGAGG - Intergenic
1185530577 X:815067-815089 AGGAGGCCACATAGAAATGACGG + Intergenic
1186634425 X:11387129-11387151 AGCAGGCTACAGGGAAATGTGGG + Intronic
1189566923 X:42251556-42251578 AGCAGCTTACATACTAATGAGGG - Intergenic
1190976202 X:55403951-55403973 CACAGGTTACACAGCAATGGAGG - Intergenic
1193488838 X:82121771-82121793 ATAAGGTTATATAGAAATGATGG + Intergenic
1196735913 X:118981039-118981061 GGCATTTTACATAGAAATGTTGG - Intronic
1197766584 X:130063229-130063251 AGCAGGTAAAAGATAAATGGAGG + Intergenic
1199675442 X:150185347-150185369 AGCAGCTAATCTAGAAATGGTGG + Intergenic
1201964519 Y:19717214-19717236 AGCTGCTTACATAGGAATTGGGG - Intronic