ID: 1081513152

View in Genome Browser
Species Human (GRCh38)
Location 11:43796424-43796446
Sequence CTGTATTAGTACATGATTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081513152 Original CRISPR CTGTATTAGTACATGATTCT GGG Intronic
900886257 1:5417706-5417728 GTTTATTAGCTCATGATTCTTGG + Intergenic
910376274 1:86575370-86575392 CTGTAATAGTTAATGTTTCTGGG - Exonic
918224666 1:182470741-182470763 CTATATTGGTACCTGATACTTGG + Intronic
918241526 1:182624421-182624443 CTGCTTTAGAACATGAATCTGGG + Intergenic
918642248 1:186856901-186856923 ATATAATAGTACATGATTCAAGG + Intronic
919268006 1:195298300-195298322 CAATAATAGTTCATGATTCTAGG - Intergenic
919790096 1:201285124-201285146 CTGTCTTAATACATAAGTCTTGG - Intronic
921821382 1:219621043-219621065 CTGGATTAGTACTTGATTGTGGG - Intergenic
924266506 1:242287307-242287329 ATCTATTTGTTCATGATTCTGGG - Intronic
1063013375 10:2049067-2049089 CTGTATCACTATATAATTCTGGG - Intergenic
1066399679 10:35063886-35063908 CGGTATTAGATTATGATTCTGGG + Intronic
1066718325 10:38311243-38311265 ATCTATTTGTTCATGATTCTGGG + Intergenic
1073158062 10:101364241-101364263 CTGTATTACATTATGATTCTAGG - Intronic
1075147811 10:119897471-119897493 CTGTGATAGTGCATGATTTTAGG + Intronic
1076417695 10:130303147-130303169 CTCTAAAATTACATGATTCTGGG - Intergenic
1079499094 11:21082175-21082197 CTGAATTAGGACATGCTTGTTGG + Intronic
1080768947 11:35322679-35322701 CTGTTTTTGTTCTTGATTCTAGG - Intronic
1081513152 11:43796424-43796446 CTGTATTAGTACATGATTCTGGG + Intronic
1086609921 11:88743334-88743356 TTTTACTAGTACAAGATTCTAGG + Intronic
1089789227 11:120930547-120930569 TTGTATTAGTACAGGATGCCTGG - Intronic
1091477603 12:791850-791872 CTGGGTTAATACATGACTCTTGG - Intronic
1093873805 12:24325571-24325593 ATGTATTAGTATATGCTTTTGGG - Intergenic
1095997470 12:48100721-48100743 CAGTTATAGTACATGACTCTAGG + Intronic
1099886798 12:88541190-88541212 CTATATTTATACATGATTCATGG - Intronic
1102563599 12:113779919-113779941 AAGTATTAGTTCATGAGTCTAGG - Intergenic
1109795227 13:67303096-67303118 CTGTATCATTCCATAATTCTGGG - Intergenic
1115086124 14:29517006-29517028 CTGTTTTGGTAGATCATTCTAGG - Intergenic
1116242592 14:42364594-42364616 CTGTACTTGTAACTGATTCTTGG - Intergenic
1116553404 14:46271420-46271442 CTTTATAAATACAGGATTCTTGG + Intergenic
1117196399 14:53343852-53343874 CTGTAATAATACCTGAGTCTTGG - Intergenic
1117292752 14:54349393-54349415 CTGAATTATTACTTCATTCTCGG - Intergenic
1118223240 14:63875278-63875300 CTGCATTATTACATGAAACTGGG - Intronic
1118240218 14:64049119-64049141 CTGGATTTTAACATGATTCTTGG + Intronic
1118458367 14:65965571-65965593 ATTTATAAGTACATGCTTCTTGG - Intronic
1119242355 14:73071386-73071408 ATGTATTCCTACATGATTGTAGG + Intronic
1122914754 14:104853609-104853631 CTGGGTGAGGACATGATTCTTGG - Intergenic
1126486833 15:49190697-49190719 CTGTAACAGTAGTTGATTCTTGG + Intronic
1130812542 15:87394977-87394999 CTGTATTGGTATAAGTTTCTGGG - Intergenic
1135853275 16:25983789-25983811 CTGTGTGAGTCCATGATTCTGGG - Intronic
1137728110 16:50670542-50670564 CTGTATTAGTCCTTGTTTCTAGG - Intronic
1137970192 16:52976987-52977009 CTGTATGAGAACATGATGCTGGG + Intergenic
1139027870 16:62841456-62841478 CTATTTTTGTAGATGATTCTTGG + Intergenic
1140539715 16:75745561-75745583 CTGTAACAGTAGATGAGTCTTGG - Intronic
1146434037 17:32826070-32826092 GTGTATTACTACTTTATTCTGGG + Intronic
1150898857 17:69246922-69246944 TTGTTCTAGTACATGATTTTAGG - Exonic
1151204762 17:72498122-72498144 TTGTATTTGTCCATGATTCTGGG - Intergenic
1152017504 17:77761314-77761336 GTGTATTAGAACATGCTTCCTGG + Intergenic
1152348056 17:79766572-79766594 CTGTAGTAGTACCTGCTACTTGG - Intergenic
1153474210 18:5480139-5480161 CTGTATGAGAACAAGCTTCTGGG + Intronic
1155304137 18:24462851-24462873 GTGTATTTGTACATGTTTATGGG - Intronic
1155997765 18:32349462-32349484 TTGTATTATTTCTTGATTCTTGG - Intronic
1156612406 18:38740500-38740522 CTGTGTTAGTACAGAATTCAAGG - Intergenic
1158927928 18:62289373-62289395 CTGTATTAAAACATGATGGTAGG - Intronic
1159062246 18:63528149-63528171 CTGTATTAGTCCATTTTTATGGG - Intergenic
1159384743 18:67708905-67708927 ATGTATCAGTACAATATTCTAGG - Intergenic
1166545011 19:43628966-43628988 CCTTATTTGTTCATGATTCTGGG - Intronic
925948599 2:8890070-8890092 CTCTGTTAGAGCATGATTCTTGG - Intronic
926269170 2:11352186-11352208 CTGTATTAGTCCATTTTTATGGG + Intergenic
927577789 2:24214225-24214247 CTGTATTTGTAAATGATAGTGGG + Intronic
928812986 2:35252364-35252386 CTGTATAATTACATAATTTTAGG + Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929462991 2:42118247-42118269 CTGCATTTTTACAGGATTCTTGG + Intergenic
929724233 2:44407436-44407458 TTGTATTAGTGCAGGATCCTTGG + Intronic
930091906 2:47536968-47536990 CTGTGTTTGGACATGATTATGGG + Intronic
930477910 2:51907782-51907804 CTGTATTTGGACATGCTTCCTGG + Intergenic
935868169 2:107415171-107415193 CTGCATAAGAACATTATTCTAGG - Intergenic
937353225 2:121181607-121181629 CTGTTTTGGTAAATGATTCTTGG - Intergenic
939057744 2:137383891-137383913 ATGTATTTGTTTATGATTCTGGG - Intronic
940747136 2:157580661-157580683 CTGGATTTGTACTTTATTCTTGG - Intronic
940931021 2:159431139-159431161 CTGAATTACTATCTGATTCTGGG + Exonic
941224103 2:162823652-162823674 CTTTTTTAGTCCATGTTTCTTGG + Intronic
942161062 2:173187931-173187953 CTCTTTTAGAAAATGATTCTAGG - Intronic
942221313 2:173771712-173771734 CTGTATCAGTCCAAGTTTCTTGG + Intergenic
943708875 2:191067004-191067026 CTTTATTAGTTCATGAGACTAGG - Intronic
946440954 2:219695366-219695388 TTTTATTTGTTCATGATTCTTGG + Intergenic
1169313341 20:4567161-4567183 ATGTATTATTACATAATTATGGG - Intergenic
1169559316 20:6782625-6782647 CTCTAATAGAACATGATTCCCGG - Intergenic
1173830593 20:46084027-46084049 CTGTATTAGAATATTATTCCTGG + Intronic
1183135951 22:35887818-35887840 TTGTATTAGAATATGATGCTAGG - Intronic
1185095823 22:48805553-48805575 CTGTATTTGTACATATTTATGGG - Intronic
949847048 3:8382319-8382341 CTGCAATAGTACACGAGTCTAGG + Intergenic
951045742 3:18036277-18036299 CTGTGTTAGGACATGGCTCTTGG + Intronic
951939977 3:28066946-28066968 CTGTGTTCCTACCTGATTCTAGG + Intergenic
952302251 3:32113724-32113746 ATTTATTAGCTCATGATTCTGGG + Intronic
953252526 3:41259677-41259699 CTGTATTTGTAAATGTTTTTTGG + Intronic
954134882 3:48577645-48577667 ATGTCTTAGCACATGAGTCTGGG + Intronic
954998550 3:54904713-54904735 CTGGATAAATACATGATTCAAGG + Intronic
962392281 3:134983083-134983105 CTGCATTATTACATGAATCTAGG - Intronic
964105929 3:153039600-153039622 CTGTATAAGAAAAAGATTCTGGG + Intergenic
966027877 3:175308382-175308404 CTGTATTAAGACAGGATGCTAGG - Intronic
968219964 3:196929762-196929784 CTGTATGTGTATATGATGCTAGG + Intronic
971670857 4:29555435-29555457 CTTCATTAGTCCATGAATCTAGG + Intergenic
972152936 4:36117761-36117783 CTAAATTAGTACTTAATTCTTGG - Intronic
972564799 4:40260129-40260151 CTGTGTTAGAAAATGATTTTGGG + Intergenic
972938103 4:44164827-44164849 ATGTATTAATAAATGAATCTAGG - Intergenic
975784955 4:77877753-77877775 CTGGATTGGTACAGGATACTGGG + Intronic
976421224 4:84846819-84846841 CTGAATTACTTCAAGATTCTAGG - Intronic
977384018 4:96315307-96315329 CTGAAATGGTACATGAATCTGGG - Intergenic
981169668 4:141606337-141606359 CTGTATTACTCCATGAAACTTGG + Intergenic
982644274 4:158003636-158003658 CTGTATAAGTACACTATTTTAGG - Intergenic
984561339 4:181274384-181274406 CTGTTTTGGTCCATGATTCTTGG + Intergenic
992695627 5:79283662-79283684 CTGTATTTCTACAGGATTCCAGG - Intronic
992900024 5:81285567-81285589 CTGTCTTGGTACCTGCTTCTTGG - Intergenic
994505142 5:100633519-100633541 CTGTCTTATTGCTTGATTCTTGG - Intergenic
995521526 5:113011426-113011448 CTGATTTAGTAGATGATACTTGG + Intronic
995936105 5:117516879-117516901 CTGTATTAAAAGATGATTATTGG - Intergenic
998397255 5:141826651-141826673 CTGTGTTTACACATGATTCTAGG - Intergenic
999486259 5:151999258-151999280 CTGGCTGAGTATATGATTCTTGG + Intergenic
1000594613 5:163200347-163200369 CTGTATGAGGACATGATGCCTGG + Intergenic
1001249361 5:170134685-170134707 CTGTATTAGTTCAGGACTCTTGG + Intergenic
1001455481 5:171856942-171856964 CAGGATAAGAACATGATTCTTGG - Intergenic
1002765903 6:238621-238643 CTATATTAGTACATATTTGTGGG + Intergenic
1003008398 6:2403502-2403524 CAGTAGTAGTGCATGGTTCTGGG - Intergenic
1003910234 6:10736845-10736867 CTGTATTTGGAATTGATTCTGGG + Intergenic
1004745739 6:18507409-18507431 CTCTGTTAGAACATGATTTTGGG + Intergenic
1005097362 6:22132058-22132080 CAGTATTAGTAACTGATTCCTGG - Intergenic
1005408647 6:25519123-25519145 CTTTATTAGTACCTTATTTTGGG + Intronic
1007524417 6:42479519-42479541 GTGTATTTGCACATGATTCTAGG + Intergenic
1009024310 6:57979871-57979893 CTGGAGTATTACATGATTCCAGG + Intergenic
1009199890 6:60731408-60731430 CTGGAGTAATACATGATTCCAGG + Intergenic
1009936500 6:70240834-70240856 TTGTATTTCTGCATGATTCTGGG - Intronic
1011056900 6:83214880-83214902 CTGTATTCTTCCATTATTCTAGG + Intronic
1011437191 6:87351098-87351120 CTGTTCAAGTACATGACTCTAGG + Intronic
1012428175 6:99137053-99137075 CTGTATTGGTACTTGAATATGGG - Intergenic
1018073449 6:160187552-160187574 TTGTATTTATACATAATTCTGGG - Intronic
1022324493 7:29318696-29318718 CTGAACTAGTACAAGTTTCTTGG - Intronic
1027379866 7:77596095-77596117 ATGTATATTTACATGATTCTGGG + Intronic
1027487447 7:78779737-78779759 CCGTATTAGTCCATGATACTGGG + Intronic
1027822574 7:83065990-83066012 CTGTATTCATCCATGTTTCTGGG + Intronic
1028291458 7:89070432-89070454 CAGTGTTATTACATCATTCTGGG - Intronic
1028296275 7:89136565-89136587 CTGTATAACTTGATGATTCTAGG + Intronic
1031119129 7:117700639-117700661 CTGTATAATTCTATGATTCTGGG + Intronic
1032313156 7:130807482-130807504 CTGGATCAGGACATGCTTCTTGG + Intergenic
1036021153 8:4848140-4848162 ATGTATTAGTACTTCATTCTTGG + Intronic
1038947519 8:32377551-32377573 CTGTTTTGGTTCATGACTCTGGG - Intronic
1041672235 8:60503062-60503084 CTCTATTAAAACATGATTCATGG + Intergenic
1043101373 8:76051494-76051516 ATTTATTTGTTCATGATTCTGGG - Intergenic
1044245350 8:89937853-89937875 ATTTATTAGGAGATGATTCTGGG - Intronic
1046236993 8:111437208-111437230 ATGTATTGATCCATGATTCTTGG - Intergenic
1047019256 8:120757249-120757271 CTGCATTCCTACATGATACTGGG + Intronic
1047989679 8:130273108-130273130 CTGTATTTATACATGTTTATGGG - Intronic
1060001139 9:119959499-119959521 TTGTATTAGTACAGGCTACTTGG + Intergenic
1060777463 9:126386044-126386066 CTGTATTAGTGTATGATTCTTGG + Intronic
1186046421 X:5541600-5541622 CTGTATTAGAACATGGCTTTTGG - Intergenic
1187146177 X:16639374-16639396 CTGTATTTGAACATGATCGTTGG - Intronic
1187590482 X:20712150-20712172 CTGTATTTCTACATGCTTCCAGG + Intergenic
1188051655 X:25494930-25494952 TTGTGTTAGTAAATGATTCCAGG + Intergenic
1188474354 X:30574284-30574306 CTGAATTAGAAAAGGATTCTTGG + Intronic
1196565767 X:117203219-117203241 CTGTAGTGCTACATGACTCTTGG - Intergenic
1197518144 X:127462392-127462414 CTTTTTTTGTACATGATTGTTGG - Intergenic
1197852267 X:130875300-130875322 TTGTATTTGTACATGAATTTTGG - Intronic
1198478002 X:137014472-137014494 CTGTTTTACTACATGATTCTGGG + Intergenic
1199408647 X:147493586-147493608 CTGTATTACCACAGGATGCTTGG - Intergenic