ID: 1081516001

View in Genome Browser
Species Human (GRCh38)
Location 11:43830708-43830730
Sequence CTGTGCCAGTATTACATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081516000_1081516001 -3 Left 1081516000 11:43830688-43830710 CCTTCATTGTTTGAAGAACTCTG 0: 1
1: 0
2: 1
3: 22
4: 194
Right 1081516001 11:43830708-43830730 CTGTGCCAGTATTACATTTCAGG 0: 1
1: 0
2: 1
3: 5
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081516001 Original CRISPR CTGTGCCAGTATTACATTTC AGG Intronic
900730299 1:4254375-4254397 CTATGCAATTATTACATCTCAGG + Intergenic
909644889 1:77905901-77905923 TTGTGCCAGTATTACAGTATGGG + Intronic
909709998 1:78637951-78637973 ATGATCCAGCATTACATTTCTGG - Intronic
912827403 1:112918271-112918293 CTGTGCCCGTTTTACATATTAGG - Intronic
913432681 1:118812577-118812599 CTGTTGCAGTAATTCATTTCTGG - Intergenic
913682279 1:121197673-121197695 CTGTGCCAGCAATAAATTTAAGG - Intronic
914034116 1:143985294-143985316 CTGTGCCAGCAATAAATTTAAGG - Intergenic
914155331 1:145082676-145082698 CTGTGCCAGCAATAAATTTAAGG + Intronic
915043991 1:152995845-152995867 TTGTACCAGTATTAATTTTCTGG + Intergenic
915926311 1:160022552-160022574 CATTTCCAGTACTACATTTCAGG - Intergenic
917067945 1:171117288-171117310 CTGGGTCAGTATGGCATTTCTGG - Exonic
919844550 1:201633427-201633449 CTGTGCCAGGATTCCATCCCAGG + Intronic
920469592 1:206216184-206216206 CTGTGCCAGCAATAAATTTAAGG - Intronic
920951047 1:210572064-210572086 CCGTGCCAGTGTAACATTTACGG - Intronic
922779760 1:228242457-228242479 TTATGCCATTATTTCATTTCTGG - Intronic
924507713 1:244701693-244701715 CTGTTCCACTATTATATTTTGGG + Intronic
1063757456 10:9030049-9030071 CTTGGCCAGTATTACAGATCAGG - Intergenic
1064226786 10:13493266-13493288 CTGTTTCAGGATTACATTTGGGG + Intronic
1072202141 10:93169810-93169832 AAGTGCCAGAATTACCTTTCTGG - Intergenic
1077851832 11:6080365-6080387 CTTTGGCAGTATTACAGCTCTGG - Intergenic
1077981557 11:7306406-7306428 CTGTGGCAGTATTAAAATGCAGG - Intronic
1080991419 11:37541112-37541134 TTGTGCCCGTATTACATTGGAGG - Intergenic
1081516001 11:43830708-43830730 CTGTGCCAGTATTACATTTCAGG + Intronic
1082215913 11:49569269-49569291 CTGTGTCAGGATTCCAATTCAGG + Intergenic
1083139103 11:60706979-60707001 CTGTACCAGTTTATCATTTCAGG + Exonic
1086633665 11:89055207-89055229 CTGTGCCAGGATTCCAATTCAGG - Intronic
1087292429 11:96334647-96334669 CTGTGCCAGGAATACATTGATGG - Intronic
1087496079 11:98892016-98892038 CTATATCAGTATTTCATTTCAGG + Intergenic
1088278606 11:108115106-108115128 AGGTGCCAGCATTACATGTCTGG - Intergenic
1089164986 11:116468973-116468995 CTGAGCCAGAATGAGATTTCAGG + Intergenic
1090525304 11:127528150-127528172 CTTTGTCAATATTAAATTTCAGG + Intergenic
1093030572 12:14284940-14284962 CTTTGCCATTATCATATTTCAGG - Intergenic
1093057599 12:14570164-14570186 TTATGCCAGTTTTACATATCTGG + Intergenic
1098235653 12:68415694-68415716 CTTTGCCTGTATGAAATTTCTGG + Intergenic
1099817649 12:87669261-87669283 CTCTGGCACTATTACATCTCAGG - Intergenic
1105444719 13:20443181-20443203 CTGTGCCAGTTTTCCACATCAGG - Intronic
1105554769 13:21436251-21436273 CTGTGTCATTATAACATTTTGGG - Intronic
1108548656 13:51521637-51521659 ATGTGCCAGTATAAGAATTCAGG - Intergenic
1111187663 13:84761157-84761179 CTGTGTCAGTAATAGATTTAAGG + Intergenic
1113285475 13:108842730-108842752 ATGATCCAGTATTACAATTCTGG + Intronic
1114776980 14:25495153-25495175 TTGGCCCAGTATAACATTTCTGG - Intergenic
1115280846 14:31661518-31661540 CTATGCCAACATTTCATTTCTGG + Intronic
1116040965 14:39686123-39686145 GTGTGCCAGTTTTACAGTGCTGG - Intergenic
1117001901 14:51378632-51378654 CAGTGCCAATATTACATGTGTGG - Intergenic
1119810911 14:77518616-77518638 CTGAACCACTATTACATATCAGG - Intronic
1123736296 15:23187583-23187605 CTGTGCACGTATTGCATTTGGGG - Intergenic
1124287003 15:28410556-28410578 CTGTGCATGTATTGCATTTGGGG - Intergenic
1124295698 15:28501071-28501093 CTGTGCATGTATTGCATTTGGGG + Intergenic
1126186060 15:45831381-45831403 CTTTTCCAGTTTTACATTTTGGG + Intergenic
1129673334 15:77619136-77619158 CTGAACCAGGATTACATTACAGG - Intronic
1134797479 16:17054437-17054459 CTCTGCCAGAACTACATTTCTGG + Intergenic
1140600022 16:76464327-76464349 CTGTGGCAGTCTTGCATTTTAGG - Intronic
1142836324 17:2590636-2590658 CTTGTCCAGTTTTACATTTCTGG - Intergenic
1144804019 17:17952053-17952075 CTGTTCCAGTATTACTTATAAGG + Intronic
1150601178 17:66652414-66652436 TTGTACCAGTGTGACATTTCTGG + Intronic
1156439765 18:37172828-37172850 ATATGCCATTGTTACATTTCAGG + Intronic
1157372031 18:47122693-47122715 CTGTGCCAGTGTGACATTGGAGG - Intronic
1159101762 18:63966117-63966139 CTGTGCCAGTGTTCCACTTAGGG - Intronic
1159803862 18:72930702-72930724 CTGAGTTATTATTACATTTCTGG - Intergenic
1163337329 19:16681820-16681842 CTGGTCCAGTAGTACATCTCAGG + Intronic
1167051572 19:47082222-47082244 CTGTGCAAGTTTTACATCACTGG - Exonic
929179720 2:39024160-39024182 CTGAACCAGTAGTACATTTTTGG + Intronic
929445695 2:41999257-41999279 CTTTGCCATTTTTACATTTAAGG - Intergenic
929873207 2:45775087-45775109 CTGAGACTGTATTACATGTCAGG + Intronic
931796419 2:65714212-65714234 TTGTTGCAGGATTACATTTCAGG + Intergenic
933303508 2:80569603-80569625 CTGTCTCAGTATTACTTTTGGGG + Intronic
933485924 2:82923432-82923454 TTCTGCCAGTTTTACATTCCAGG - Intergenic
935467203 2:103412453-103412475 CAGTACCAGTTTTACGTTTCTGG - Intergenic
940771480 2:157843712-157843734 CAGTGCCAGTATTCTATTGCAGG - Intronic
942465411 2:176202710-176202732 CTGTGCCAGAATTACATTCCAGG + Intergenic
944757372 2:202777467-202777489 CAGTGACAGTATTACATTCTGGG + Exonic
946473793 2:219988306-219988328 TTGTGCCACTAAAACATTTCAGG + Intergenic
947916576 2:233836061-233836083 CTGAGCCAGCATTACACTGCCGG + Intronic
1169477851 20:5948737-5948759 TGGTGCAGGTATTACATTTCCGG + Intronic
1169554366 20:6734039-6734061 CTGTTCCATGATCACATTTCAGG + Intergenic
1169985785 20:11442548-11442570 CGGTGGCAGTATTACTTTCCTGG - Intergenic
1172784572 20:37458681-37458703 CTGTACCAGTATGAGACTTCAGG - Intergenic
1176002922 20:62841376-62841398 CTGTGACAGTATTTCATTTGTGG + Exonic
1177390451 21:20461964-20461986 ATGATCCAGTATTCCATTTCTGG + Intergenic
1179168824 21:38957111-38957133 CTTTCCCAGAAATACATTTCGGG + Intergenic
1182205546 22:28621348-28621370 CAGAGCCAGTATTATAGTTCAGG - Intronic
1182683215 22:32099373-32099395 CTATGCCAGAATGACTTTTCTGG - Intronic
1184745922 22:46455881-46455903 CTGGGGCATTATTTCATTTCTGG - Intronic
955412605 3:58665487-58665509 CTGTGCAAGTTTTCCCTTTCTGG + Intronic
956371200 3:68563839-68563861 CTGTGTCAGTGTTACATGGCGGG - Intergenic
956573618 3:70726124-70726146 CTATTCCAGTATTCCATTTGAGG + Intergenic
959269599 3:104190839-104190861 ATGGGACATTATTACATTTCTGG - Intergenic
959773819 3:110133080-110133102 CTGTGCTAGTATTCCCTTTGTGG + Intergenic
960479383 3:118170636-118170658 CTGTGCTTGGATTACATATCTGG - Intergenic
963933577 3:151029159-151029181 CTTTTCCAGTTTTACATTCCTGG - Intergenic
965524832 3:169704997-169705019 ATGTGTCAGTCTTTCATTTCAGG + Intergenic
966623049 3:181986412-181986434 CTGTGCGAGTATTCCAGTCCAGG - Intergenic
968259095 3:197304780-197304802 GTGTGCCAGTCTTTCATTTTTGG + Intergenic
970394276 4:15650123-15650145 AGGTGTCAGTAGTACATTTCCGG - Intronic
970487006 4:16534953-16534975 ATGTGTCATAATTACATTTCTGG - Intronic
972619471 4:40733046-40733068 CTGTGCCCTTATCACCTTTCTGG + Intergenic
975835683 4:78420167-78420189 ATGTGACAGGATTACATTTGGGG - Intronic
976888890 4:90020695-90020717 CTGTGGCAGAAGTACATTGCAGG + Intergenic
977039329 4:91995211-91995233 TTTTGCCAGTACCACATTTCTGG - Intergenic
977753835 4:100641680-100641702 CTGTAACAATATTGCATTTCTGG - Intronic
982283650 4:153712293-153712315 CTGTGCCTATATTACTATTCTGG - Intronic
983236291 4:165183609-165183631 CTTTGCCAGAAATACGTTTCTGG - Intronic
983371865 4:166870151-166870173 CTGGTCCAGTATCCCATTTCAGG + Intronic
984028138 4:174569825-174569847 CTCTGCCAGTCTCACAATTCAGG - Intergenic
986169612 5:5304930-5304952 GTGTGCATGTATTAAATTTCAGG - Intronic
988106612 5:26758096-26758118 CTGTGCCATTTTTACATTCTCGG - Intergenic
988874759 5:35431744-35431766 CTTTGTCAGTATTGCATTTTTGG + Intergenic
991217253 5:64169987-64170009 GTGAGCCAGTATTCCACTTCTGG + Intronic
991292037 5:65042486-65042508 CTGTGTCGATGTTACATTTCTGG - Intergenic
993015332 5:82528948-82528970 CTTTTCCAGTGTTACATTGCTGG + Intergenic
995069375 5:107900914-107900936 CAGAGACAGTATTACATTTCAGG + Intronic
997710472 5:135999854-135999876 CTGTGCCACAAGTCCATTTCGGG - Intergenic
999319909 5:150607717-150607739 CTGTGCTCGCATTACGTTTCAGG - Intronic
1008389928 6:50938428-50938450 GTGTGCCAACATGACATTTCTGG - Intergenic
1012332888 6:98015984-98016006 GTCTCCCAGTATTTCATTTCAGG + Intergenic
1012619923 6:101330825-101330847 TCTTGCCAGTTTTACATTTCAGG - Intergenic
1019506081 7:1392169-1392191 CGGTGCCTGTATTTCCTTTCCGG + Intergenic
1024327128 7:48117654-48117676 CTGGGCCAGGATTACCTTTTGGG - Intergenic
1024446088 7:49480920-49480942 CAGTGGCTTTATTACATTTCAGG - Intergenic
1025784267 7:64630182-64630204 CTGTGCCTGTATTAGTTTGCTGG - Intergenic
1026081880 7:67228999-67229021 CTGTGCCAGTTTTATTTTTTTGG + Intronic
1027509430 7:79061164-79061186 CTGTGCCATTATAAATTTTCAGG + Intronic
1027616327 7:80429340-80429362 CTCTTCCATTTTTACATTTCTGG - Intronic
1039326804 8:36494216-36494238 CTGTGCCAGGATGACATCACAGG + Intergenic
1039987586 8:42460806-42460828 GTGTGCCAGTGTTACATTGATGG - Intronic
1040652896 8:49469143-49469165 CTTTTCCAGTCTTACAGTTCTGG - Intergenic
1041481546 8:58326440-58326462 CTGTTCCAGTATAGCATTTAAGG - Intergenic
1041549861 8:59088484-59088506 CTGCTCCAGCATTACATTTTGGG + Intronic
1046288593 8:112128908-112128930 CAGATCCAGTGTTACATTTCAGG - Intergenic
1047481276 8:125285911-125285933 CTGTGCCAGGATTTGAATTCAGG + Intronic
1053491101 9:38503743-38503765 CTGTTCCAGGATTCCATATCAGG + Intergenic
1055098796 9:72441657-72441679 CTGTCCCAGTATTTCTTTTCTGG - Intergenic
1058244767 9:102609092-102609114 CTGTGCCTCCATTGCATTTCAGG + Intergenic
1058816600 9:108688762-108688784 CTGTGCCAGGTTTTGATTTCAGG - Intergenic
1059677984 9:116558438-116558460 CTGAGCCAGAATTACATAACAGG + Intronic
1186097046 X:6113587-6113609 CTGGGCCATTTTTACAGTTCAGG - Intronic
1187190685 X:17032061-17032083 CAGTGCCAGTATTTCATCTAGGG - Intronic
1191934207 X:66408867-66408889 CTGTTCTAGGGTTACATTTCAGG + Intergenic
1192766139 X:74141450-74141472 CTCTGCCAGGATTTGATTTCAGG - Intergenic
1194224800 X:91243893-91243915 CTGTTACAGGATTATATTTCTGG + Intergenic
1194496676 X:94624438-94624460 CTGAGCCAATATTACATACCAGG - Intergenic
1196037849 X:111166594-111166616 CTGGCCCATTACTACATTTCAGG + Intronic
1196243226 X:113367406-113367428 CTGCCCCAGGAATACATTTCTGG + Intergenic
1196353508 X:114760975-114760997 CTGTGCCAGAAGTAGATTTTAGG + Intronic
1198714625 X:139543924-139543946 TTGTGCCATTATTTTATTTCTGG + Intronic
1200561263 Y:4707203-4707225 CTGTTACAGGATTATATTTCTGG + Intergenic
1201723985 Y:17134167-17134189 AGGTGGCAGTCTTACATTTCTGG - Intergenic