ID: 1081516325

View in Genome Browser
Species Human (GRCh38)
Location 11:43833939-43833961
Sequence CATTGTGTACAGCTGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 172}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081516323_1081516325 -9 Left 1081516323 11:43833925-43833947 CCTGGAATTATAAACATTGTGTA 0: 1
1: 0
2: 3
3: 16
4: 189
Right 1081516325 11:43833939-43833961 CATTGTGTACAGCTGGAGCCAGG 0: 1
1: 0
2: 1
3: 8
4: 172
1081516322_1081516325 -8 Left 1081516322 11:43833924-43833946 CCCTGGAATTATAAACATTGTGT 0: 1
1: 0
2: 1
3: 25
4: 275
Right 1081516325 11:43833939-43833961 CATTGTGTACAGCTGGAGCCAGG 0: 1
1: 0
2: 1
3: 8
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081516325 Original CRISPR CATTGTGTACAGCTGGAGCC AGG Intronic
903028260 1:20444673-20444695 AGTTGTGTAGAGGTGGAGCCAGG - Intergenic
904013026 1:27400679-27400701 CATTGTGACTGGCTGGAGCCAGG + Intergenic
904419107 1:30380009-30380031 CACTGTGCACAGCAGGAGCTGGG + Intergenic
906818756 1:48906640-48906662 CATTGTATGCAGATGGAGCGAGG + Intronic
907050965 1:51329900-51329922 CATTGGGTGCAGCAGGAACCTGG - Intronic
907148273 1:52256864-52256886 CTTTGTGAACAGCTGGACACTGG + Intronic
909118953 1:71575980-71576002 CATTTTGTACCGCTGCAGACTGG - Intronic
913557037 1:119977904-119977926 CATTGTGTATAGTCAGAGCCTGG - Intronic
914665385 1:149828461-149828483 CATTATGTCCAGCTGGTTCCGGG - Intergenic
914670380 1:149865333-149865355 CATTATGTCCAGCTGGTTCCGGG + Intronic
915086670 1:153394004-153394026 CTTTGGGGACAGCAGGAGCCAGG + Intergenic
915149413 1:153818153-153818175 CATTCTGTACAACTGGAGTCTGG + Exonic
918176685 1:182052912-182052934 CATTGTGTTCAGTTTGTGCCAGG - Intergenic
918238247 1:182600312-182600334 CACTCTGTCCAGCTGCAGCCTGG - Exonic
920806864 1:209242934-209242956 CCTTGTCAACAGCTGGAGCAAGG - Intergenic
921632862 1:217455839-217455861 CCTTGTCTGCTGCTGGAGCCTGG - Intronic
924145918 1:241074487-241074509 CTTCAGGTACAGCTGGAGCCAGG + Intronic
1065578448 10:27147787-27147809 CATTGTGCACGCCAGGAGCCAGG - Intronic
1068953019 10:62796253-62796275 AATTGGGCACAGCTGGTGCCAGG - Intergenic
1071727471 10:88213987-88214009 CATTGGGCACAGCTGGATTCAGG + Intergenic
1076742322 10:132492735-132492757 CAGTGGGAACAGCTGGAGCCAGG - Intergenic
1077166280 11:1140915-1140937 CGTGGTGTTCAGCTGGAGCAGGG - Intergenic
1077298656 11:1837522-1837544 CTGTGTGTCCGGCTGGAGCCTGG + Intergenic
1079138819 11:17793927-17793949 TATTGTGTCCAGCTTGTGCCAGG - Intronic
1080600487 11:33817423-33817445 CATTGTGTAGAGGTGGTGCATGG + Intergenic
1081516325 11:43833939-43833961 CATTGTGTACAGCTGGAGCCAGG + Intronic
1082105472 11:48216857-48216879 CACTCTGCACAGCTGGATCCTGG - Exonic
1083272169 11:61578084-61578106 CAGAGTGTGGAGCTGGAGCCTGG + Intronic
1084600348 11:70141825-70141847 AAATGTGAACAGCTGGAGGCCGG - Intronic
1090024560 11:123156619-123156641 CATTTTGTACAGCTGGAAGAAGG + Intronic
1090434166 11:126673051-126673073 CCCAGTGTAGAGCTGGAGCCAGG + Intronic
1090879815 11:130823680-130823702 CTTTGAGTCCAGCTGCAGCCAGG - Intergenic
1095267394 12:40176204-40176226 CATTGTATATAGATGGAGGCAGG + Intergenic
1096239987 12:49954668-49954690 CAGTGACGACAGCTGGAGCCAGG - Exonic
1099867612 12:88303597-88303619 CATTGTGCCCACCTGGTGCCTGG - Intergenic
1102646425 12:114406725-114406747 CCTTGTGTACACCTGGAGCAGGG - Intronic
1104216290 12:126736953-126736975 CATTCTATGCACCTGGAGCCTGG - Intergenic
1105214416 13:18275965-18275987 CATGGGGCACAGCTGAAGCCTGG + Intergenic
1105581962 13:21706455-21706477 CATTATGTGGAGCTGGAGTCAGG + Intergenic
1105751442 13:23425313-23425335 CCTTGTGTCCACCTGGGGCCTGG + Intronic
1107995642 13:45857659-45857681 TAATGTGTACAGCTGGATTCTGG - Intergenic
1110438356 13:75500124-75500146 CATGGTGTACAGTTGAAGGCAGG - Intergenic
1110833746 13:80061111-80061133 CATTGGGTACTGCAGGAACCTGG - Intergenic
1113030842 13:105992060-105992082 CATTGTGAGCAGCTGGATTCAGG - Intergenic
1113564226 13:111308997-111309019 CACTGTGGAGAGCTGGAGACAGG - Intergenic
1114075636 14:19159765-19159787 CTATGTGTTCACCTGGAGCCTGG + Intergenic
1114086525 14:19239807-19239829 CTATGTGTTCACCTGGAGCCTGG - Intergenic
1115429965 14:33305638-33305660 CATTGATTACAGCTGTATCCAGG + Intronic
1117343602 14:54812031-54812053 CATCAGGTACAGCTGGATCCAGG + Intergenic
1118602483 14:67480548-67480570 CAGTGTGTTCCCCTGGAGCCTGG - Intronic
1120227691 14:81809532-81809554 TGTTATGTGCAGCTGGAGCCTGG + Intergenic
1122489731 14:102106164-102106186 CATTGTGTATTGGTAGAGCCTGG + Intronic
1125442063 15:39713821-39713843 CAGTGAAAACAGCTGGAGCCAGG + Intronic
1127389994 15:58497664-58497686 CATTGTGCTGACCTGGAGCCTGG - Intronic
1127890037 15:63242283-63242305 CATTGTATAAAGCTGGAGCTAGG + Intronic
1131050769 15:89346433-89346455 CAGTTTGGACAGGTGGAGCCAGG - Intergenic
1131472304 15:92707975-92707997 CCTCGTGTCCAGCTGGAGCCAGG + Intronic
1131669778 15:94607530-94607552 CATTATGTGCAGCAGGATCCAGG - Intergenic
1132641410 16:980232-980254 CATTGGGAACAACCGGAGCCAGG - Intronic
1133134350 16:3699269-3699291 TATTGTGAACTGCTGGGGCCAGG - Intronic
1133778722 16:8919755-8919777 CATTGTGTACAGAGGGAGATGGG - Intronic
1138262472 16:55634975-55634997 AATTGGTTGCAGCTGGAGCCAGG + Intergenic
1138285916 16:55810188-55810210 CACTGTGGACAACTGGAGCGGGG - Intronic
1141293943 16:82749236-82749258 CTTTAGGTACAGCTGGATCCAGG - Intronic
1141929862 16:87195174-87195196 CATTTTCTACACCTTGAGCCAGG - Intronic
1142585820 17:972650-972672 CTTTGTGCACAGCTGGGGTCGGG - Intronic
1142645176 17:1307106-1307128 GAAGGTGTCCAGCTGGAGCCAGG + Intergenic
1143107794 17:4538150-4538172 GGTGGTGTACAGCTGCAGCCAGG - Exonic
1144312209 17:14024063-14024085 CCTTGTGTCCACCTGGGGCCTGG - Intergenic
1144640911 17:16935996-16936018 CAGTGTGTCCAGGTGGTGCCAGG - Intronic
1144839642 17:18177983-18178005 CATTGTGCACTGTGGGAGCCAGG + Intronic
1145347192 17:22048623-22048645 CCTGGTGTACACCTGGGGCCTGG + Intergenic
1147159719 17:38562952-38562974 CATTGTGCACAGCTGGGGGATGG - Intronic
1147423444 17:40334035-40334057 CACTCTGTCCATCTGGAGCCTGG + Intronic
1150609947 17:66725987-66726009 CACTGTGGGCAGCTGGAGCTCGG + Intronic
1151944944 17:77314675-77314697 CAGTGTGTACTCCTGGAGCAAGG + Intronic
1152876204 17:82787587-82787609 CATCATGTACAGCAGGCGCCCGG - Intronic
1155226914 18:23737175-23737197 CATGGAGTACAACAGGAGCCAGG - Intronic
1155281948 18:24249561-24249583 CATGCTGTACAGCTGTTGCCAGG - Intronic
1157871365 18:51232798-51232820 CAGTGTGTGCTTCTGGAGCCTGG + Intergenic
1161463699 19:4415133-4415155 CATTCTACCCAGCTGGAGCCCGG - Intronic
925130640 2:1491922-1491944 CACTGTGGACAGCAGGAGTCAGG + Intronic
929050017 2:37828487-37828509 CAGTGGGGACAGCTGAAGCCGGG + Intergenic
929454585 2:42056852-42056874 CATTTTAGACAGTTGGAGCCAGG - Intronic
930574805 2:53133439-53133461 AATTGGTTGCAGCTGGAGCCAGG - Intergenic
935734406 2:106095634-106095656 CCCTGTGTCCAGCAGGAGCCCGG - Intronic
938490227 2:131757265-131757287 CCATGTGTTCACCTGGAGCCTGG + Intronic
939168547 2:138666535-138666557 TATTGTGTTCAGCTGAAGCAAGG + Intergenic
941352794 2:164456798-164456820 CATTGTGCCCAGATGCAGCCTGG + Intergenic
941905785 2:170715664-170715686 CGATGGGTGCAGCTGGAGCCAGG + Intronic
946548456 2:220773894-220773916 CAGTGGGTACAGATGAAGCCAGG - Intergenic
947237025 2:227951431-227951453 TATTGTGTAGTGATGGAGCCTGG - Intergenic
1170447614 20:16445310-16445332 CATTCTGTACTCCTGGACCCTGG + Intronic
1170504037 20:17005582-17005604 CATTATGTCCAGATGGACCCAGG + Intergenic
1170954229 20:20963862-20963884 CAGTGTGGACAGTTTGAGCCTGG + Intergenic
1174168398 20:48600737-48600759 CACTGTGGGCAGCTGGGGCCTGG + Intergenic
1175789287 20:61731482-61731504 CATAGGGTGCACCTGGAGCCTGG + Intronic
1176707401 21:10126273-10126295 CCATGTGTTCACCTGGAGCCTGG + Intergenic
1180028309 21:45181702-45181724 CATAGTTTACATCTGAAGCCAGG + Intronic
1180291338 22:10852931-10852953 CTATGTGTTCACCTGGAGCCTGG + Intergenic
1180494143 22:15882353-15882375 CTATGTGTTCACCTGGAGCCTGG + Intergenic
1180940661 22:19658005-19658027 CATTCTGTCCAGCTAGGGCCTGG + Intergenic
1181670310 22:24422802-24422824 CATTGGGCACAGCTGGACACTGG + Intronic
1182557050 22:31134791-31134813 TAATGTATACAGCTGGTGCCTGG - Exonic
1183323478 22:37178972-37178994 GATTGTGTACAAATAGAGCCTGG + Intergenic
1184891847 22:47384530-47384552 CATTGTGAAGAGAAGGAGCCAGG + Intergenic
1184967875 22:47994757-47994779 CTTGGTGTGGAGCTGGAGCCGGG + Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
1185173596 22:49306971-49306993 CTCTGTGCAGAGCTGGAGCCGGG - Intergenic
1185242575 22:49754613-49754635 CACTGGGCACAGCTGGGGCCTGG - Intergenic
950475989 3:13215140-13215162 TCTTGTGTACTGCAGGAGCCTGG - Intergenic
953475101 3:43198906-43198928 CACTGTGGTCAACTGGAGCCTGG + Intergenic
954283952 3:49604685-49604707 CCTGGTGGACAGCTGGAGCAGGG + Intronic
957012399 3:75022951-75022973 CATTGTGTAGAGGTGAAGTCTGG + Intergenic
962409305 3:135127482-135127504 CATTGTGCATTGCTGAAGCCAGG - Intronic
964296705 3:155240957-155240979 GAGTGTGGGCAGCTGGAGCCAGG + Intergenic
964915684 3:161838618-161838640 CATTGGTTGCAGCTGGTGCCAGG - Intergenic
966224205 3:177580768-177580790 CATTGTGGAGAAATGGAGCCAGG + Intergenic
969689781 4:8698131-8698153 CAGTGTGGACAGATGGACCCGGG - Intergenic
969697724 4:8744590-8744612 CATGGGGTTCAGCTGGAGGCTGG - Intergenic
970450368 4:16160336-16160358 CATTGTGTAGAGTTGTAGCTGGG - Intergenic
972628453 4:40822952-40822974 CAGTGTGGCCAGCTGGAGGCAGG + Intronic
973532585 4:51847747-51847769 CACTGAGGGCAGCTGGAGCCGGG - Intronic
976712148 4:88084158-88084180 CCTTGTGTGCAGGTGTAGCCTGG - Intergenic
978495932 4:109358978-109359000 CATTGAGGAGAGCTGGAGCCTGG - Intergenic
979154114 4:117360723-117360745 CATTGGTTGCAGCTGGTGCCAGG - Intergenic
980158324 4:129132711-129132733 CCTTGTGTTCACCTGGAGACTGG - Intergenic
983191346 4:164756675-164756697 GATTGTTTACATCTGGAGGCAGG - Intergenic
985563016 5:601424-601446 CCTGGTGCACAGGTGGAGCCCGG - Intergenic
985922577 5:2990250-2990272 AAGTGTGTACAGCTGTAGTCTGG - Intergenic
986324484 5:6661895-6661917 CATAGTGTCCAGTTGGAACCTGG + Intronic
987076623 5:14388358-14388380 CACTGTGGACATCTGGGGCCAGG - Intronic
987082771 5:14440760-14440782 CTTTGTGTACATCTGGAGGGAGG - Intronic
996902321 5:128556564-128556586 CAATGAGAACAGCTGGACCCAGG + Intronic
997117374 5:131139560-131139582 CATTGTGGAAAGCTGGAGAATGG + Intergenic
999169055 5:149577800-149577822 CATTGTGTAAAGCAGGGCCCTGG + Intronic
1001975845 5:175997709-175997731 CAGTCTGTACAGGCGGAGCCAGG + Intronic
1001981986 5:176044172-176044194 CTTTGTGTCCAGCTGTGGCCTGG + Intergenic
1001982753 5:176047752-176047774 CCTGGTGTCCACCTGGAGCCTGG + Intergenic
1002234710 5:177796305-177796327 CCTGGTGTCCACCTGGAGCCTGG - Intergenic
1002241580 5:177846063-177846085 CAGTCTGTACAGGCGGAGCCAGG - Intergenic
1002644344 5:180645830-180645852 CAGTGTGTCCAGCTGGAGCCAGG - Intronic
1002645605 5:180651716-180651738 TATTGTGTACAGGTGAAGTCTGG + Intergenic
1003613348 6:7632700-7632722 AATGGTGTTCAGCTGGAGGCTGG - Intergenic
1007984366 6:46192972-46192994 TATTTTGTACTGCTGGTGCCTGG - Intergenic
1012426066 6:99115994-99116016 TATTATGTTCACCTGGAGCCAGG + Intergenic
1012908414 6:105093351-105093373 CACTGTGCCCAGCTGGATCCTGG - Intergenic
1015731384 6:136351900-136351922 CACTGTGCACTGCAGGAGCCAGG - Intronic
1019784355 7:2965472-2965494 CACTGAGTATAGCTGGAGTCCGG - Intronic
1021964627 7:25905517-25905539 CAGGGTGGACAGCTGGTGCCCGG + Intergenic
1024209245 7:47189778-47189800 CATTGTGTATTGCTCGAGTCTGG + Intergenic
1024375168 7:48629266-48629288 CATAGTGTACAGTTGGATTCTGG - Intronic
1027994770 7:85411731-85411753 CATTGGCTACAGCTGCAGCAGGG + Intergenic
1031155538 7:118106479-118106501 CAATGTGTATAGCTGGCTCCAGG + Intergenic
1032722636 7:134563235-134563257 CAGTGGGAAGAGCTGGAGCCTGG - Intronic
1033095299 7:138425298-138425320 AATTGGTTACAGCTGGTGCCAGG - Intergenic
1039897789 8:41728494-41728516 CATTGTGTAGTGGTGAAGCCTGG - Intronic
1040991675 8:53358150-53358172 ATTTTTGTACAGGTGGAGCCTGG + Intergenic
1043501851 8:80866358-80866380 CTGTGTGTACAGCAGGAACCTGG + Intronic
1046612428 8:116440851-116440873 GATTTTGAACAGCTGGAGGCTGG - Intergenic
1048917917 8:139202143-139202165 CAGTGTGGAGAGCTGGACCCTGG + Intergenic
1049528890 8:143143407-143143429 CATTGTGGAAAACTGGGGCCTGG - Intergenic
1049953973 9:674304-674326 CATTGTGTTCACCTGGAGAGAGG - Intronic
1053644588 9:40112993-40113015 CCATGTGTTCACCTGGAGCCTGG + Intergenic
1053761394 9:41351858-41351880 CCATGTGTTCACCTGGAGCCTGG - Intergenic
1054350167 9:64013403-64013425 CCATGTGTTCACCTGGAGCCTGG - Intergenic
1054539988 9:66262976-66262998 CCATGTGTTCACCTGGAGCCTGG - Intergenic
1056637376 9:88342444-88342466 CATTGTGTACTTCTGTGGCCAGG + Intergenic
1057479711 9:95434978-95435000 CTTTGGGTACAGCTTGACCCGGG + Intergenic
1057624420 9:96664977-96664999 CATTGTGTACTGGTGGAGACTGG + Intergenic
1059246040 9:112850513-112850535 CACTGTGTGCAGCCAGAGCCCGG - Intronic
1059385135 9:113958707-113958729 CCTGGTGTACTGCTGGAGCCTGG + Intronic
1062249608 9:135587630-135587652 CACTGTGGACAGCTGGGGCAGGG - Intergenic
1202792148 9_KI270719v1_random:95153-95175 CCATGTGTTCACCTGGAGCCTGG + Intergenic
1187700396 X:21959752-21959774 CATTGTGCACAACCTGAGCCTGG + Intronic
1190445007 X:50515203-50515225 CATTCTGTAGAGCAGGAGGCTGG + Intergenic
1190558902 X:51668136-51668158 CATTGTGTGAAGATGGGGCCTGG + Intergenic
1190565389 X:51725186-51725208 CATTGTGTGAAGATGGGGCCTGG - Intergenic
1192197154 X:69036176-69036198 CAGTGTGTACAGGGGAAGCCAGG - Intergenic
1193066621 X:77267307-77267329 AATTGGTCACAGCTGGAGCCAGG + Intergenic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1200376818 X:155790243-155790265 CATTGTGTACTGATGAAGTCTGG - Intergenic