ID: 1081519460

View in Genome Browser
Species Human (GRCh38)
Location 11:43867691-43867713
Sequence TGGATATTCCTGGGTATAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081519460_1081519464 -4 Left 1081519460 11:43867691-43867713 CCGTCTATACCCAGGAATATCCA No data
Right 1081519464 11:43867710-43867732 TCCAAGCAATTAGGCCACCGAGG No data
1081519460_1081519468 30 Left 1081519460 11:43867691-43867713 CCGTCTATACCCAGGAATATCCA No data
Right 1081519468 11:43867744-43867766 TCCCAGCTTATTCATCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081519460 Original CRISPR TGGATATTCCTGGGTATAGA CGG (reversed) Intergenic
No off target data available for this crispr