ID: 1081519460 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:43867691-43867713 |
| Sequence | TGGATATTCCTGGGTATAGA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1081519460_1081519464 | -4 | Left | 1081519460 | 11:43867691-43867713 | CCGTCTATACCCAGGAATATCCA | No data | ||
| Right | 1081519464 | 11:43867710-43867732 | TCCAAGCAATTAGGCCACCGAGG | No data | ||||
| 1081519460_1081519468 | 30 | Left | 1081519460 | 11:43867691-43867713 | CCGTCTATACCCAGGAATATCCA | No data | ||
| Right | 1081519468 | 11:43867744-43867766 | TCCCAGCTTATTCATCTCTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1081519460 | Original CRISPR | TGGATATTCCTGGGTATAGA CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||