ID: 1081519464

View in Genome Browser
Species Human (GRCh38)
Location 11:43867710-43867732
Sequence TCCAAGCAATTAGGCCACCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081519460_1081519464 -4 Left 1081519460 11:43867691-43867713 CCGTCTATACCCAGGAATATCCA No data
Right 1081519464 11:43867710-43867732 TCCAAGCAATTAGGCCACCGAGG No data
1081519455_1081519464 22 Left 1081519455 11:43867665-43867687 CCTGTTCTGTCCCAATCCATTTA No data
Right 1081519464 11:43867710-43867732 TCCAAGCAATTAGGCCACCGAGG No data
1081519457_1081519464 11 Left 1081519457 11:43867676-43867698 CCAATCCATTTACTTCCGTCTAT No data
Right 1081519464 11:43867710-43867732 TCCAAGCAATTAGGCCACCGAGG No data
1081519456_1081519464 12 Left 1081519456 11:43867675-43867697 CCCAATCCATTTACTTCCGTCTA No data
Right 1081519464 11:43867710-43867732 TCCAAGCAATTAGGCCACCGAGG No data
1081519458_1081519464 6 Left 1081519458 11:43867681-43867703 CCATTTACTTCCGTCTATACCCA No data
Right 1081519464 11:43867710-43867732 TCCAAGCAATTAGGCCACCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081519464 Original CRISPR TCCAAGCAATTAGGCCACCG AGG Intergenic
No off target data available for this crispr