ID: 1081519468

View in Genome Browser
Species Human (GRCh38)
Location 11:43867744-43867766
Sequence TCCCAGCTTATTCATCTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081519462_1081519468 20 Left 1081519462 11:43867701-43867723 CCAGGAATATCCAAGCAATTAGG No data
Right 1081519468 11:43867744-43867766 TCCCAGCTTATTCATCTCTCTGG No data
1081519465_1081519468 10 Left 1081519465 11:43867711-43867733 CCAAGCAATTAGGCCACCGAGGA No data
Right 1081519468 11:43867744-43867766 TCCCAGCTTATTCATCTCTCTGG No data
1081519467_1081519468 -6 Left 1081519467 11:43867727-43867749 CCGAGGAGCAGTACATGTCCCAG No data
Right 1081519468 11:43867744-43867766 TCCCAGCTTATTCATCTCTCTGG No data
1081519461_1081519468 21 Left 1081519461 11:43867700-43867722 CCCAGGAATATCCAAGCAATTAG No data
Right 1081519468 11:43867744-43867766 TCCCAGCTTATTCATCTCTCTGG No data
1081519460_1081519468 30 Left 1081519460 11:43867691-43867713 CCGTCTATACCCAGGAATATCCA No data
Right 1081519468 11:43867744-43867766 TCCCAGCTTATTCATCTCTCTGG No data
1081519466_1081519468 -3 Left 1081519466 11:43867724-43867746 CCACCGAGGAGCAGTACATGTCC No data
Right 1081519468 11:43867744-43867766 TCCCAGCTTATTCATCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081519468 Original CRISPR TCCCAGCTTATTCATCTCTC TGG Intergenic
No off target data available for this crispr