ID: 1081521915

View in Genome Browser
Species Human (GRCh38)
Location 11:43889996-43890018
Sequence CAGGAGAAACAGCAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 769
Summary {0: 1, 1: 1, 2: 11, 3: 77, 4: 679}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081521905_1081521915 25 Left 1081521905 11:43889948-43889970 CCTAAGAAAGTAGAATTAGCCAA 0: 1
1: 0
2: 1
3: 28
4: 292
Right 1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG 0: 1
1: 1
2: 11
3: 77
4: 679
1081521909_1081521915 6 Left 1081521909 11:43889967-43889989 CCAAAAAGGACAGGGAAGAGTAT 0: 1
1: 0
2: 1
3: 27
4: 283
Right 1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG 0: 1
1: 1
2: 11
3: 77
4: 679

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081521915 Original CRISPR CAGGAGAAACAGCAGGTGGA AGG Intronic
900001497 1:17225-17247 CAGCTGGAACAGCAGGTGGGAGG - Intergenic
900021216 1:187747-187769 CAGCTGGAACAGCAGGTGGGAGG - Intergenic
900695327 1:4006126-4006148 CAGGAGAAATTGCAGATGGCAGG - Intergenic
900779128 1:4606144-4606166 CAGCAGATACAGCAGGTACAGGG - Intergenic
900903739 1:5535820-5535842 CTGCAGAAACATCAGCTGGATGG + Intergenic
901182535 1:7351495-7351517 CAGCAGAAGCAGCAGGTCGGGGG + Intronic
901266828 1:7917248-7917270 AAGTAGAAAAAGAAGGTGGAGGG + Exonic
901635031 1:10666514-10666536 CAGGAGCTCCAGCAGGTGCAGGG + Intronic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902205252 1:14863747-14863769 CAGGGGAAACTGAAGGTGCACGG + Intronic
902403854 1:16172545-16172567 CAGGAGAAACAGTAGGGTGGAGG - Intergenic
902469623 1:16639339-16639361 CAGGAGAGACAGCAGGTGGTAGG - Intergenic
903003470 1:20282857-20282879 CAGGAGAGACAGCAGGGTGCAGG + Intergenic
903367853 1:22815996-22816018 CAGGTGACACAGCACGTGAATGG - Intronic
903390826 1:22962665-22962687 CAGATGGAACAGCACGTGGAAGG - Intronic
903646662 1:24900239-24900261 CAAGAGAAACCGCAGCAGGAGGG + Exonic
904004718 1:27357703-27357725 CAGAAGCAAGAGCAGGTGGGCGG - Exonic
904269894 1:29343072-29343094 CAGTACAAACAGTATGTGGATGG - Intergenic
904308906 1:29612559-29612581 AAGAAGAAAGAGAAGGTGGAAGG - Intergenic
904849055 1:33443486-33443508 CAGGGAGAACAGCAGGTAGAGGG + Intergenic
906209283 1:44003153-44003175 CAGGGGCTGCAGCAGGTGGAGGG - Intronic
906593295 1:47048513-47048535 CAGGAGAAAGAGCAAGTTGTGGG - Intronic
906617174 1:47241387-47241409 CAGGAGAAGGAGCTGGAGGAAGG - Intergenic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906816490 1:48885627-48885649 CAAGAGAAACAGCAGAAGAAAGG - Intronic
907371751 1:54008134-54008156 CTGGAGAAAGAGCAGCTTGAAGG - Intronic
907734365 1:57097415-57097437 CAGGAGAAGAAGGAGCTGGAGGG + Intronic
907913297 1:58846101-58846123 CAGAGGAAACAGCATGGGGAAGG - Intergenic
908295972 1:62713443-62713465 AAGAAGAAAGAGAAGGTGGAAGG - Intergenic
908679297 1:66641865-66641887 TAGGAGAAAAAGCAGAGGGAAGG - Intronic
909068558 1:70964498-70964520 CAGGAAAGACAGCATGTGCAGGG + Intronic
909344638 1:74571507-74571529 TAGGAAAAACAGCAGCTGCAGGG - Exonic
909352254 1:74667979-74668001 CAGGAGAGAAAGCAAGTGAAAGG - Intronic
909561834 1:77016181-77016203 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561842 1:77016205-77016227 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561850 1:77016229-77016251 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561858 1:77016253-77016275 GAGGAGATACAGGAGGAGGAGGG - Intronic
909583814 1:77266829-77266851 CAGAAGAAACAGCAAGTGAGAGG + Intergenic
910455691 1:87395186-87395208 CAGGAAAAGCAGCAGTGGGAGGG + Intergenic
910491430 1:87776680-87776702 TAGGAGAAGATGCAGGTGGAAGG - Intergenic
910799771 1:91133422-91133444 CAGGAGAAAAAGGAGGGGAAAGG - Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
911110989 1:94185111-94185133 CTGGGCAAACTGCAGGTGGAAGG + Intronic
912023643 1:105138973-105138995 CTTGAGAGACAGCAGGTAGATGG - Intergenic
912273154 1:108230194-108230216 CAGGGCATACAGCAGGTGCAAGG + Intronic
912295066 1:108464128-108464150 CAGGGCATACAGCAGGTGCAAGG - Intronic
912667801 1:111598805-111598827 CAGTAGAAACCACAGGTTGAGGG + Intronic
912788633 1:112628983-112629005 CAGGAGCAACAGCAGAAGCAGGG - Intronic
913283797 1:117209657-117209679 CAGGAGAAGCAGTGGGTGGCAGG - Intronic
913403829 1:118465611-118465633 CAGGAGAGAAAGCAAGTGAAGGG - Intergenic
913509688 1:119550450-119550472 CAGGAGAAAGAGAAGGCGCACGG + Intergenic
914333401 1:146693865-146693887 CAGGAGAGACAGCAAGTGAGAGG + Intergenic
915946123 1:160152939-160152961 CAGGAGAAACACCTGTTGGGAGG + Intronic
917127100 1:171696685-171696707 CAGGAGAAACAGCAAGTCCAAGG + Intergenic
918621907 1:186614909-186614931 AAAAAGAAACAGGAGGTGGAAGG + Intergenic
919197268 1:194302111-194302133 CTTGAGAAACAGCAGTTTGAGGG + Intergenic
920045436 1:203129348-203129370 CCAGAGAAACAGGAGGGGGATGG + Intronic
920306014 1:205018579-205018601 CAGGGTAAACAGCAGGGGGTGGG + Exonic
920517533 1:206597372-206597394 TAGGAAAAGCAGGAGGTGGAAGG + Intronic
920531913 1:206708275-206708297 CAGGGGAAACAAGAGGTGGCTGG - Intronic
920704112 1:208239498-208239520 AAAGAAAACCAGCAGGTGGATGG - Intronic
921477842 1:215631937-215631959 CAGTAGAAACAGGTGGTGGGAGG - Intronic
921533250 1:216311443-216311465 AATGAGAAACACCAAGTGGATGG - Intronic
921692476 1:218165691-218165713 GAGGAGAAACAGCCAGAGGACGG + Intergenic
922415962 1:225423525-225423547 CAGGAAAAACAGCAGTTGATGGG - Intronic
922792993 1:228320769-228320791 GATGATAAACAGCAGATGGATGG - Intronic
922986194 1:229867704-229867726 CACTAGAAACTGCAGGAGGAAGG - Intergenic
923647336 1:235837246-235837268 CAGGAGAAAAATCAGGTGAGTGG + Intronic
924280342 1:242430694-242430716 GAGGAGAACCAGCAGGTAGAAGG - Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063112113 10:3046549-3046571 CAGGTGAGAGAGCAGGTGGGAGG - Intergenic
1063112119 10:3046587-3046609 CAGGTGAGAGAGCAGGTGGGGGG - Intergenic
1063112127 10:3046625-3046647 CAGGTGAGAGAGCAGGTGGGGGG - Intergenic
1063355583 10:5395524-5395546 GAGGACTAGCAGCAGGTGGACGG - Intronic
1063649494 10:7918853-7918875 AAGGAGGGATAGCAGGTGGAAGG + Intronic
1064005181 10:11693680-11693702 CAGGAGGAACAGCTGGTGTGAGG - Intergenic
1065108925 10:22420930-22420952 CAGGAGAACCAGCAGCAGGTTGG + Intronic
1065874391 10:29984187-29984209 CAGGTGAGCCAACAGGTGGAGGG + Intergenic
1066214399 10:33272497-33272519 GAGGAGAAAGAGGAGGAGGAGGG + Intronic
1066476421 10:35751401-35751423 CAGGAGATACAGCAGAATGAGGG - Intergenic
1066806962 10:39266633-39266655 CAGGATAAAAAGTAGATGGAAGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1068203904 10:53822460-53822482 GAGGAGAAATAGGAGGAGGAGGG + Exonic
1068952291 10:62789697-62789719 CAGGACACACAGGAGCTGGAAGG - Intergenic
1070569714 10:77631783-77631805 CAGGCCAAACAGCAGGGGGCAGG + Intronic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071855027 10:89615430-89615452 CAGGAGATGAAGCAGGAGGAAGG - Intronic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072259285 10:93652987-93653009 TAGGAAAAAAAGCAGGGGGAGGG - Intronic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072608348 10:97001420-97001442 CAGGAGGAAGAGGAGGAGGAGGG + Intronic
1073330841 10:102669066-102669088 AAGAAGAAAAAGCAGGAGGAAGG - Intergenic
1073912597 10:108363782-108363804 CAGCAGGAACAGCAGCTGGGGGG + Intergenic
1074813863 10:117130510-117130532 AAGGAGAAACAGCTGCAGGAGGG - Intronic
1074827712 10:117226734-117226756 GAGGAGAGACAAGAGGTGGATGG + Intergenic
1074945862 10:118280010-118280032 AAGGAGAATAAGGAGGTGGAAGG - Intergenic
1075148045 10:119899998-119900020 CAGGAGGAGAAGCAGGAGGAAGG - Intronic
1075398731 10:122146245-122146267 GGGGAGAAACAGCATGTGCATGG + Intronic
1076333114 10:129686146-129686168 CAGCAGAAACAGAAACTGGAGGG + Intronic
1076395507 10:130135589-130135611 CAGGAGACACAGGAAGTGCAAGG + Intergenic
1076599161 10:131645954-131645976 GAGGAAAAGGAGCAGGTGGAGGG - Intergenic
1076623913 10:131810164-131810186 CAGGAGGAAAAGCAGGATGATGG + Intergenic
1077233639 11:1469629-1469651 CAGGAGCAGGAGCAGGTGCAGGG + Intronic
1077311822 11:1892143-1892165 AAGGAGAAACTGCAGGTCAAGGG + Exonic
1077349629 11:2086450-2086472 CAGGGGACTCAGCAGGTGGACGG + Intergenic
1077541780 11:3150092-3150114 CAGGGGAAACAGCTGCTGGTTGG - Intronic
1077978311 11:7273149-7273171 CAGAAGTAAGAGCAGGTAGAGGG + Intronic
1078019246 11:7641476-7641498 CAGGAGACACAGAAAGTGGCTGG + Exonic
1078142671 11:8703239-8703261 CAGGACAAACAGCCTCTGGAAGG - Intronic
1078296385 11:10075606-10075628 CAGGAGAGACAGCAAATGAAGGG - Intronic
1078328073 11:10396659-10396681 GAGAAGCAACAGCTGGTGGAGGG + Intronic
1078508323 11:11967984-11968006 CAGGGGAAGCAACAGGTGTAGGG + Intronic
1080394208 11:31875063-31875085 CAGGAGCAGCAGGAGGGGGAAGG - Intronic
1080505765 11:32911665-32911687 CAGGAGAGACAGCAAGTGCAAGG - Intronic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1081548744 11:44092980-44093002 TAGGAGAAAGAGCTGGTGTAGGG - Intergenic
1081700585 11:45150138-45150160 CAGAAGGAACAGCATGAGGAAGG - Intronic
1081743510 11:45457295-45457317 CAGGAGAAACAGCAGCTGTAAGG + Intergenic
1081752611 11:45522695-45522717 TAGGAGTAGGAGCAGGTGGAGGG + Intergenic
1082809045 11:57467621-57467643 CAGGAGCATCAGCAGGAGGCAGG - Exonic
1082821690 11:57548288-57548310 CAGAGGAAACAGCAGGTGCAAGG - Intronic
1082827148 11:57588228-57588250 CAGGAGAGAGAGCAAGTGAAAGG - Intergenic
1083164206 11:60873582-60873604 CAGGAGGCAGAGCAGGTGGGGGG - Intronic
1083296915 11:61719893-61719915 CAGGAGAGACTCCAGGGGGAAGG + Intronic
1083331188 11:61899107-61899129 CAGGAGAAAGACCAGCCGGACGG + Intronic
1083777926 11:64903240-64903262 CTGGAGCCACAGCAGGTGCAGGG - Intronic
1084096586 11:66915443-66915465 CTGGAGACACAGCAGGGAGAAGG - Intronic
1084359874 11:68662218-68662240 CGTAAGAAACAGAAGGTGGAGGG + Intergenic
1084554174 11:69865864-69865886 CAGGAGAAATGGCAGGAGTAGGG + Intergenic
1084851354 11:71943811-71943833 CAGGAGGAGCAGCATGTGCAAGG + Intronic
1084915222 11:72423900-72423922 TAGAGGGAACAGCAGGTGGAAGG - Intronic
1085643918 11:78210338-78210360 CAGGCGGAGCAGCAGGGGGATGG - Exonic
1086026840 11:82303928-82303950 CAGGAGAAGCAGTGGATGGAAGG - Intergenic
1086558656 11:88141778-88141800 CAGAGGAAACAGCACGTGAAAGG - Intronic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089542785 11:119200379-119200401 CAGGAGAAGGAGGTGGTGGAGGG - Intergenic
1090699770 11:129283086-129283108 CAGGAGAAAGATCACGGGGAGGG - Intergenic
1090933947 11:131325045-131325067 CATGAGAAACACCAGGGAGAAGG + Intergenic
1090972153 11:131653267-131653289 TAAGAGAGACAGCAGGTGGAGGG - Intronic
1091374582 12:17340-17362 CAGCTGGAACAGCAGGTGGGAGG - Intergenic
1091404745 12:202198-202220 CAGGGGGAAGAGCAGGTGCAGGG - Intronic
1091522440 12:1259929-1259951 CAAGAAAAACAGCAGATGTATGG - Intronic
1092071668 12:5636554-5636576 GAGAGAAAACAGCAGGTGGAAGG + Intronic
1092238051 12:6821989-6822011 GGGCAGAAACAGCAGGTGGCTGG - Intronic
1093097002 12:14983245-14983267 CAGGAGAGAAAGCAGGTGCCTGG - Intergenic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1095535311 12:43239212-43239234 CATGAGAAAGGGCAGGGGGAAGG - Intergenic
1095862589 12:46934552-46934574 CAGGAGAAACACCAGGGTCAGGG - Intergenic
1096193245 12:49633413-49633435 CAGGAGCAGCTGCAAGTGGATGG - Exonic
1096783005 12:54001566-54001588 AAGGAGAAACAGCAGGGGAGGGG + Intronic
1097426633 12:59453787-59453809 CAGGAGAAAGAGCAGGAATAAGG + Intergenic
1097699648 12:62807044-62807066 CAGTAGCAACAGCAGGTGCAAGG + Intronic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098364517 12:69688730-69688752 CAGAAGAAAGAGAAGCTGGAGGG + Intronic
1098440973 12:70517947-70517969 CAAGAGAATCAGCATGTGAAGGG + Exonic
1098574564 12:72026621-72026643 GAGAAGAAAGAGCAGGAGGAAGG - Intronic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099305415 12:80948586-80948608 AAGGAGAAACAAGAGGTAGAAGG + Intronic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1100449926 12:94696063-94696085 GAGGAGCAGCAGCAGGGGGAAGG + Intergenic
1100698263 12:97119025-97119047 GAGATGAAACAGCAGCTGGAAGG - Intergenic
1101787650 12:107899344-107899366 CAGGAGAAAGATCAGTGGGAAGG - Intergenic
1102115693 12:110401541-110401563 CAGGAGGAACAGCAAGTACAAGG + Intronic
1102625895 12:114235291-114235313 CAGGAGAATCAACAGGGGGCTGG - Intergenic
1103235377 12:119368177-119368199 GAGGAGAAAAAGGAGGGGGAAGG + Intronic
1103238490 12:119394704-119394726 CAGGAGATGCAACAGCTGGAAGG - Intronic
1103283807 12:119783681-119783703 CAGCAGAAAGTGCAGGTAGACGG - Intronic
1103560769 12:121792367-121792389 CAGGAGAAACAGTCAGTGGGAGG - Intronic
1103658231 12:122491854-122491876 CAGGTGAAACACTAGGTGAATGG + Intronic
1103961929 12:124614305-124614327 GAGCAGCCACAGCAGGTGGAAGG - Intergenic
1104310044 12:127646409-127646431 GAGAAGAAGAAGCAGGTGGAGGG + Intergenic
1104655375 12:130570533-130570555 CAGGAGCAACAGAAGGTGACAGG + Intronic
1104661292 12:130613015-130613037 AGGGAGAAACAGCTGGTGAATGG - Intronic
1105303919 13:19156290-19156312 CAGGATGAAGAGCAGGTGGAAGG - Intergenic
1105358865 13:19687570-19687592 GAGGAGAAAGGGCAGATGGAAGG - Intronic
1105600748 13:21884842-21884864 CAGGACAAACAGGAGGGGGGTGG + Intergenic
1105923371 13:24985071-24985093 CAGAAGATACAGCAGGAGAAGGG + Intergenic
1106176673 13:27337862-27337884 CAGGAGAAACAGCCTGTGGCTGG + Intergenic
1106231728 13:27825941-27825963 CAGGAGAGAAAGGAGGAGGAAGG + Intergenic
1106423225 13:29601270-29601292 CAGGAGAAACTGGTGGGGGAGGG + Intergenic
1106449627 13:29868348-29868370 CAGAAGAATCACCAGGTAGAGGG - Intergenic
1106609103 13:31261524-31261546 CAGGAGGGACAGCTAGTGGAAGG + Intronic
1106906602 13:34415894-34415916 GAGGAGACACAGCAGCTGGAAGG + Intergenic
1107037509 13:35916871-35916893 CAGGAGAGAAGGGAGGTGGAAGG - Intronic
1107624345 13:42267705-42267727 CTGAAGAAACAGCCTGTGGAAGG + Intergenic
1108257904 13:48628352-48628374 CAGGAGAGAGAGCATGTGCAGGG + Intergenic
1109586350 13:64409733-64409755 CCTGAGAAACAACAGATGGAGGG + Intergenic
1111716515 13:91886208-91886230 CAAGAGAGACAGCATGTGCAGGG + Intronic
1112024853 13:95402740-95402762 GAGGAGAAAAAGCGGGTGGGGGG - Intergenic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1113059250 13:106303501-106303523 CAGAAGACTGAGCAGGTGGAGGG + Intergenic
1113090906 13:106616950-106616972 CAAGTGAGACAGCATGTGGAGGG - Intergenic
1113188572 13:107717985-107718007 CTGGAACAACAGCAGGTGGAGGG - Intronic
1113339633 13:109409483-109409505 CAGGAGAAAAAGAAGGTTGGTGG + Intergenic
1113399288 13:109976383-109976405 GAGGAGAGCCAGCAGCTGGAAGG - Intergenic
1113660273 13:112103018-112103040 GGGGTGAAACAGCAGGAGGAAGG + Intergenic
1114356869 14:21919721-21919743 AACAAGAAACAGCAGGTAGAAGG - Intergenic
1114390931 14:22308019-22308041 CAAGAGAAAGAGCAGGTGTGTGG + Intergenic
1115653131 14:35417698-35417720 CAGGAGGAAGAGCAGGTTGAGGG + Intergenic
1115786979 14:36837323-36837345 CAGGAGAAGGAGGAGGTGAAGGG + Intronic
1115896190 14:38090360-38090382 TTGGAGAAACAGCAGGAAGAAGG + Intergenic
1115921492 14:38379244-38379266 CAGAGGAAACAGCAAGTGAATGG + Intergenic
1116579254 14:46617798-46617820 CAGGAGAGAGAGCAAGTGAATGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1118010927 14:61609738-61609760 CTGGAGACACAGCAGAGGGAAGG - Intronic
1118201672 14:63679870-63679892 CAGGAGGAAGAGAAGGTGAAGGG + Intergenic
1118723269 14:68609052-68609074 CAGGAGAAGGAACAGGTGAAGGG - Intronic
1119326785 14:73764582-73764604 GAGAAGACACAGCTGGTGGAGGG - Intronic
1119474069 14:74917105-74917127 CAGGAGAAGCAGCTGGAGTAAGG + Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1119712787 14:76835006-76835028 CAAGAGAAGTAGCAGGTGGAAGG - Intronic
1119781395 14:77278684-77278706 TGGGAGACAGAGCAGGTGGAGGG - Intronic
1119922230 14:78457045-78457067 GAGGAGAAAGAGGAGGTGGCGGG - Intronic
1119996831 14:79262438-79262460 GAGGAGAAAGAGGAGGAGGAAGG + Intronic
1120192297 14:81450325-81450347 CAGGAGGAGCTGCAGGTTGATGG + Intergenic
1120865719 14:89293802-89293824 CTGGAGAGACTGCATGTGGAAGG - Intronic
1120923170 14:89773204-89773226 AAGGGGAAAGAGCACGTGGAGGG + Intergenic
1121414609 14:93770484-93770506 CAGAGGAAACAGCATGTGCAAGG - Intronic
1121511553 14:94516509-94516531 CAGGTGCACCAGCAGGTGAAGGG + Intronic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122011671 14:98754345-98754367 AAGTAGAAACAGAGGGTGGAAGG + Intergenic
1122523088 14:102360472-102360494 CAGGACACACAACAGCTGGATGG + Intronic
1122638026 14:103139229-103139251 CAGGAGACTCCGCAGGAGGAAGG + Intergenic
1122908604 14:104815503-104815525 CAGGAGCGCCGGCAGGTGGACGG - Intergenic
1124047253 15:26161710-26161732 CAGCAGTACCAGCAGGAGGAAGG - Intergenic
1124402415 15:29361033-29361055 CAGGAAAAGCACCAGGTGCAGGG - Intronic
1126168922 15:45677945-45677967 CAGGAGGCCGAGCAGGTGGATGG - Intronic
1126177091 15:45745815-45745837 CAGAGGAAACAGCAGGTGTGAGG + Intergenic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1127144007 15:56006533-56006555 CAGGAGAGAAAGCATGTAGATGG - Intergenic
1127263013 15:57339427-57339449 CAAGAGAGACAGCTGGTGGTGGG - Intergenic
1127314943 15:57785978-57786000 CAGGAGAAGGAGCAGGTGACGGG - Intergenic
1127691595 15:61402537-61402559 TAGGACAAAGGGCAGGTGGATGG + Intergenic
1127800835 15:62476208-62476230 CAGGTGACAAAGCAGGAGGAGGG - Intronic
1128177671 15:65570525-65570547 CTGAAGAAACAGGAGGTTGAAGG + Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128704151 15:69826308-69826330 CAAGGGAACCAGCAGGTGGTTGG - Intergenic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1128733598 15:70036957-70036979 CAGGAGGGTCAGCAGGTGGAGGG - Intergenic
1128779778 15:70351755-70351777 CAGAAGAAACAGTAGGTGTGTGG - Intergenic
1129153120 15:73701567-73701589 TAGAGGAAACAGCAGGTGGAAGG - Intronic
1129672483 15:77614945-77614967 CAGGAGATCCAGCTGGTGGGCGG - Exonic
1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG + Intronic
1130424965 15:83787820-83787842 AAGGAGAAAGAGGAGGGGGAGGG - Intronic
1130681589 15:86001641-86001663 AAAGAGAAAGAGCAGGGGGAGGG - Intergenic
1130822232 15:87507856-87507878 CAGCAGAAACTGCAGGTGCAAGG - Intergenic
1130960421 15:88655244-88655266 TAGGAGACTCAGCAGGTGGCTGG - Intronic
1131353123 15:91719466-91719488 TAGGAGAAAGACCATGTGGAGGG - Intergenic
1132397140 15:101482309-101482331 CAGGAGAAACATCAGCTGGTGGG + Intronic
1132452013 15:101973713-101973735 CAGCTGGAACAGCAGGTGGGAGG + Intergenic
1132454882 16:16908-16930 CAGCTGGAACAGCAGGTGGGAGG - Exonic
1132571876 16:647791-647813 CAGGTGCAACAGCAGCTGGATGG + Exonic
1132875952 16:2137274-2137296 CAGGTCACACAGCAGGTGGATGG + Intergenic
1133392405 16:5420937-5420959 GAGGAGGAAAAGCAGGAGGAAGG - Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134335232 16:13293037-13293059 CAAGAGAAACAGCAGTTTGCAGG - Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1137486707 16:48897262-48897284 CAGGAGAAACAGGAGGTAAGTGG + Intergenic
1137507376 16:49065878-49065900 TAGAAAAAAGAGCAGGTGGAAGG - Intergenic
1138089842 16:54165139-54165161 AAGGACACACAGGAGGTGGAGGG - Intergenic
1138209257 16:55149330-55149352 CAGAAGAAAAACCAAGTGGAGGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138412934 16:56853950-56853972 CAGGAGAAACAGCAGGACTCAGG + Intergenic
1138492753 16:57385929-57385951 CAGGAGATCCAGGAGGTGGAGGG - Intergenic
1139432253 16:66917546-66917568 AAAGAGAAACAGCAAGAGGAAGG + Intronic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1139699858 16:68701508-68701530 CAGGAGAAACAGATCCTGGAAGG - Intronic
1140000217 16:71017385-71017407 CAGGAGAGACAGCAAGTGAGAGG - Intronic
1140209888 16:72961497-72961519 CAGGAGGAGCAGCAGGGGAATGG - Intronic
1140691491 16:77488603-77488625 CAGAGGAAACAACAGATGGAAGG - Intergenic
1141263070 16:82471327-82471349 AAGGAGAAACAGAAGGGGAAGGG - Intergenic
1141337992 16:83175490-83175512 CAGGAGAAACTGTATGGGGATGG + Intronic
1141727555 16:85799750-85799772 CAGGTGAGACAGGAGGTGGCCGG + Exonic
1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG + Intergenic
1142525379 17:536639-536661 CAGAACAAACCGCAGCTGGATGG + Intronic
1142599055 17:1044180-1044202 CAGGGGCAAGAGCCGGTGGAGGG + Intronic
1142879839 17:2875751-2875773 CAGGCACGACAGCAGGTGGAAGG - Intronic
1143039587 17:4023879-4023901 CAAAAGAAACAGCAGATGAATGG + Intronic
1143040692 17:4034035-4034057 CAGGCTAAAGAGCAGGTGGGTGG + Exonic
1143162115 17:4878637-4878659 CAGCAGTGAGAGCAGGTGGAAGG + Intronic
1143374468 17:6459074-6459096 CAGGTGAATGAGAAGGTGGAAGG - Intronic
1144508100 17:15850644-15850666 CAGGAGAGACAGCAGCTGCTGGG - Intergenic
1144517544 17:15929064-15929086 CAGGAGAAACAGCATCTTCAGGG + Intergenic
1144588483 17:16503584-16503606 CAGGAGAGAGAGCCAGTGGAGGG + Intergenic
1144752977 17:17662843-17662865 GAGAAGGAACAGCAGGAGGAGGG - Intergenic
1145172220 17:20668282-20668304 CAGGAGAGACAGCAGCTGCTGGG - Intergenic
1146118672 17:30168180-30168202 AAGGACAAACAGCTGGTGAATGG - Intronic
1146122456 17:30207732-30207754 CAGGAGAAACAGAGGGCTGATGG + Exonic
1146830507 17:36065073-36065095 TAGGAGAAGCAGCAGATGCATGG - Intronic
1147319014 17:39634897-39634919 CAGGAAAAGCAGCAGGTGGCTGG + Intronic
1147321100 17:39646689-39646711 CAGGACAAACAGGAGGTGGCTGG - Intronic
1147535137 17:41315871-41315893 CTGGATAAACAGCAGTTGGCAGG - Intergenic
1147760589 17:42795313-42795335 CAGGAGCAACGGGAGGGGGAAGG - Exonic
1147818613 17:43228442-43228464 CAGCAGAAAGAACAGGTGCATGG - Intergenic
1147831896 17:43303144-43303166 CAGCAGAAAGAACAGGTGCATGG - Intergenic
1148070441 17:44905701-44905723 CAGCAGCAGCAGCAGGTGGCAGG + Intronic
1148733601 17:49852057-49852079 CAGGAGATAAAGCAGGGGCAGGG + Intergenic
1148774415 17:50087644-50087666 CAGGACAAACAGCAGGTGCCTGG + Intronic
1149620928 17:58044445-58044467 CAAGAGAGACAGCATGTGCAGGG - Intergenic
1150238268 17:63610860-63610882 CAGGTGAAGCAGCAGCTGGACGG - Intergenic
1150808943 17:68341387-68341409 AGGGAGAAACAGTATGTGGAGGG - Intronic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1152845273 17:82595921-82595943 GATGAGAAACGACAGGTGGAAGG + Intronic
1153396732 18:4630513-4630535 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1154032376 18:10765224-10765246 CAGAAGAAATAGCAGGTCCAAGG + Intronic
1154100660 18:11470067-11470089 CAGGAGAGACAGCGAGTGAAGGG + Intergenic
1155555863 18:27018831-27018853 CAGGAGAGAGAGCAGGAGAATGG + Intronic
1155641844 18:28026923-28026945 CAACAGAATCAGCAGGTAGAAGG + Intronic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156924849 18:42563856-42563878 CAGGAGACAGAGCAGGAAGAAGG + Intergenic
1157644444 18:49252737-49252759 CAGAGGAAACAGCCAGTGGAGGG + Intronic
1158275190 18:55759216-55759238 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1158958076 18:62561369-62561391 CAGGAGAAACTGGAGGTGAGTGG - Intronic
1159109698 18:64042615-64042637 CAGGCAAAACAGCACGTGCAGGG + Intergenic
1159200450 18:65176952-65176974 GAGGAGAAAAGGGAGGTGGAGGG + Intergenic
1159333383 18:67030844-67030866 CAGGAGCAACAGAAAGTGGGAGG - Intergenic
1159874952 18:73800626-73800648 CAGCAGAGGCAGCAGCTGGACGG + Intergenic
1160319399 18:77876282-77876304 AAGAAGAAACAGCAGCTGGCTGG + Intergenic
1160527966 18:79548284-79548306 CAGCAGGGCCAGCAGGTGGAAGG - Intergenic
1160555739 18:79723801-79723823 AGGGAGGGACAGCAGGTGGAGGG - Intronic
1160623526 18:80187609-80187631 CAGGGGAGCCAGGAGGTGGATGG - Intronic
1160837481 19:1131678-1131700 CTGGAGAAGCCTCAGGTGGAGGG - Intronic
1160873754 19:1288003-1288025 CCGGAGCAACAGGAGGTGGCTGG - Intronic
1160955898 19:1691610-1691632 CAGAGGACACGGCAGGTGGACGG - Intergenic
1161547604 19:4891244-4891266 CAGCAGCAACGGCAGGTTGAAGG + Exonic
1161728613 19:5945276-5945298 CAGGAGAAACATCCCGTGCAGGG - Intronic
1161740917 19:6020713-6020735 CAGGAAAGGCAGCAGCTGGACGG + Intronic
1162984119 19:14258384-14258406 CAGGAGGAGGAGCAGGGGGAAGG - Intergenic
1163262934 19:16202044-16202066 CAAGAGTGACAGCAGGGGGAGGG + Intronic
1163352530 19:16787003-16787025 GAGGATAAACTGCAGTTGGAAGG - Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163508272 19:17720622-17720644 CAGGGGAAACAGCTGTTGCAAGG + Intronic
1163660602 19:18574876-18574898 CAGGCGCAACACCAGGTGCAGGG - Exonic
1164441704 19:28284492-28284514 AAGGGGAAAGAGGAGGTGGAGGG + Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164671503 19:30074678-30074700 CAGGAGAGACTGGAGGAGGAAGG - Intergenic
1164724798 19:30458862-30458884 CAGGAGAGATGGGAGGTGGAAGG - Intronic
1165426188 19:35746681-35746703 CATGGGAAACAGAAGCTGGAAGG - Intronic
1165742159 19:38210885-38210907 CAGGGGAAGAAGGAGGTGGATGG + Intergenic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166211076 19:41306811-41306833 TAGGAAGAACAGGAGGTGGAAGG - Exonic
1166382485 19:42362235-42362257 GATGAGAAGCAGCAGGTGTAGGG + Intronic
1166864970 19:45830310-45830332 CTGGAGAGGCAGCAGGGGGATGG - Intronic
1166978852 19:46621144-46621166 CAGGAGAAACAGCAGCTGATCGG + Exonic
1167173391 19:47848827-47848849 CAGAGGAAACAGCTGGGGGAAGG - Intergenic
1167360529 19:49028135-49028157 CAGGAGCCACAGCAGGAGGATGG - Intronic
1167363119 19:49040665-49040687 CAGGAGCCACAGCAGGAGGATGG + Intergenic
1167365448 19:49052921-49052943 CAGGAGCCACAGCAGGAGGATGG - Intergenic
926135198 2:10331354-10331376 CAGGAGGAAACGCAGGAGGAGGG - Intronic
926371661 2:12184873-12184895 CAGGAGAAACAGCAGAGCAAAGG + Intergenic
926412434 2:12618115-12618137 CAGGAGAAACCACATGGGGAGGG + Intergenic
926558306 2:14386564-14386586 GAGGAGAAGCAGGAGGGGGAGGG + Intergenic
926638093 2:15205774-15205796 CAGGAGAGAGAGGGGGTGGAAGG - Intronic
926881080 2:17543819-17543841 AAGGAGAAAAAACAGGAGGAAGG - Intronic
926906428 2:17809969-17809991 CAGCAGACACAGCAAGAGGATGG - Intergenic
927149852 2:20189237-20189259 CAGTATAAAGAACAGGTGGAGGG - Intergenic
927217429 2:20675934-20675956 CAGGAGGAACTGCAGCTGGATGG - Intergenic
928217584 2:29375124-29375146 CATGAGAAACAGCAGCAGCAAGG + Intronic
928584970 2:32750284-32750306 CAGCAGAGCCAGCAGTTGGAAGG + Intronic
928964289 2:36961903-36961925 CAGAAGGAACAGCTGGGGGAAGG - Intronic
929000694 2:37344766-37344788 CACCAGCAGCAGCAGGTGGAGGG - Exonic
929005678 2:37390656-37390678 CAGGGGAAACTCCAGGTGGGAGG + Intergenic
929098227 2:38284337-38284359 TAGGAGAAAGAGAAGGTAGAAGG + Intergenic
929273447 2:39999702-39999724 CAGGAGAAACATCGGGGAGAGGG - Intergenic
929821160 2:45274817-45274839 CAGCTCAGACAGCAGGTGGAAGG + Intergenic
930153929 2:48086113-48086135 CAGGCAAGAGAGCAGGTGGAGGG + Intergenic
930525248 2:52520854-52520876 GAGGAGAAACTGCAGGGGCAAGG + Intergenic
930924525 2:56800632-56800654 CAGAAGAAACAGCAGATGCAAGG + Intergenic
931196092 2:60053615-60053637 GAGGAGAAAGTGCTGGTGGAGGG - Intergenic
931376361 2:61711997-61712019 CAGGAGAAAGGGCAGGTGTCAGG - Intergenic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
931983749 2:67721871-67721893 CAGGATCAACACCATGTGGAAGG - Intergenic
933003775 2:76962374-76962396 CATGAGAAAAGGGAGGTGGAAGG - Intronic
933939810 2:87235754-87235776 CAGGAGAACCAGGCAGTGGACGG + Intergenic
933946395 2:87289592-87289614 CACGTGGAACAGCAGGTGGAGGG - Intergenic
934934954 2:98458722-98458744 CAGGAGAAACAAAAGGTGTTGGG + Intronic
935064880 2:99638756-99638778 CAGGAAAAACAGGCGGTGGGGGG - Intronic
935091803 2:99901739-99901761 CTGGAGAAAGAGCAGATGCAGGG - Intronic
935638144 2:105266291-105266313 CAGGACCGACAGCGGGTGGAAGG - Exonic
935794724 2:106630100-106630122 CAGCAGAAACAGCATGAAGAAGG - Intergenic
936327617 2:111519301-111519323 CTAGAGAAACTGCTGGTGGAGGG - Intergenic
936333800 2:111571949-111571971 CACGTGGAACAGCAGGTGGAGGG + Intergenic
936353327 2:111730019-111730041 CAGGAGAACCAGGCAGTGGACGG - Intergenic
936568228 2:113596189-113596211 CAGCTGGAACAGCAGGTGGGAGG + Intergenic
937251205 2:120524923-120524945 AAAGGGAAACAGCAGGTAGAGGG - Intergenic
938463934 2:131514795-131514817 CAGGATGAGGAGCAGGTGGAAGG + Intergenic
938508846 2:131918302-131918324 CATGAGAAGCATCACGTGGATGG - Intergenic
939732980 2:145808359-145808381 CAGCAGAAACAGCAGGGAGAGGG - Intergenic
941779306 2:169427001-169427023 CCGGAGAAAGTGGAGGTGGAGGG + Intergenic
941989092 2:171537381-171537403 GAGGAGAAAAAGCATGAGGAGGG + Intronic
943006409 2:182392270-182392292 CAAGAGAGACAGCATGTGCAGGG + Intronic
943665838 2:190607301-190607323 CAGGGGCAACAGCAAGTGGGTGG + Intergenic
945253855 2:207787723-207787745 CAGACGAAACATCAGGTGTAAGG + Intergenic
946217094 2:218192784-218192806 CAAGAGAAACAGCAAGTTTAGGG + Intergenic
946385846 2:219384075-219384097 CAGGAAAAGCAGCAGGAGCAAGG + Intronic
946414783 2:219534528-219534550 CAGCAGAAACAGAAGGTGAGAGG - Intronic
946577700 2:221094236-221094258 CAGGAGAAAATGCAGCTAGAGGG + Intergenic
946986867 2:225283121-225283143 TTGGAGAAACAGAAGGTGGTGGG - Intergenic
947722939 2:232380341-232380363 CAGGGGGCACAGCAGGGGGAGGG + Intronic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948486611 2:238285324-238285346 CAGGAGGAAAAGCAGCTGGTGGG + Intronic
948978921 2:241482733-241482755 CAGGAGGAGCAGCAGGTGTCCGG - Intronic
1168756432 20:321618-321640 CAGAGGAAACAGCAAGTGCAAGG - Intergenic
1168954229 20:1823639-1823661 TTAGAGAAACAGCAGGTGGTAGG - Intergenic
1169208383 20:3752532-3752554 CAGGAGGAGCCGCAGGAGGAAGG + Exonic
1169939854 20:10925340-10925362 CAGGAGAGAGAGCAGATGGCTGG + Intergenic
1170651320 20:18245270-18245292 CAGGAGAGCCAGCAGGAGCAGGG + Intergenic
1171154505 20:22859778-22859800 CAGAAGAAACAGCATGTGCAAGG - Intergenic
1171523213 20:25791472-25791494 AGGAAGAAACTGCAGGTGGAGGG - Intronic
1171530956 20:25853452-25853474 AGGAAGAAACTGCAGGTGGAGGG - Intronic
1171543052 20:25979218-25979240 CAGGTGCACCAGAAGGTGGAGGG - Intergenic
1171553613 20:26064411-26064433 AGGAAGAAACTGCAGGTGGAGGG + Intergenic
1172106296 20:32519084-32519106 CAGGACACACAGCAGCTGAATGG + Intronic
1172240749 20:33411132-33411154 TAGGAGAAAGAGTGGGTGGAGGG - Intronic
1172636649 20:36414562-36414584 AAGGTCACACAGCAGGTGGAGGG - Intronic
1173253224 20:41375461-41375483 CCAGAGAAACAGGAGGAGGATGG - Intergenic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173646880 20:44638921-44638943 CAGAAGGAACAGCATGTGCAAGG + Intronic
1173937733 20:46881718-46881740 CAGGAGAGACTGCAGCTGGTAGG + Intergenic
1174286742 20:49479461-49479483 CAGCGGAAACAGCAAGTGCAAGG + Intronic
1174408331 20:50317495-50317517 CCGAAGAAAAAGCAGGTGGTAGG - Intergenic
1174582595 20:51582714-51582736 CAGGAGAACCAGCCGTGGGAGGG + Intergenic
1174641774 20:52050482-52050504 GAGGAGAAAGAGGAGGAGGAAGG - Intergenic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175466308 20:59192868-59192890 CAGGAGAAGTGGCAGGTGTACGG + Exonic
1175774147 20:61642307-61642329 ATGGGGAACCAGCAGGTGGATGG + Intronic
1175814892 20:61878209-61878231 CAGGGGGAACAGAAGGTGGGAGG - Intronic
1176605229 21:8824717-8824739 CAGGTAAAAGAGGAGGTGGATGG - Intergenic
1176715628 21:10346918-10346940 CAGAAGAAACAGCAGGTACAAGG - Intergenic
1176784646 21:13240246-13240268 CATGAGAAGCATCACGTGGATGG + Intergenic
1177982694 21:27934091-27934113 CATGAGAAGCATCACGTGGACGG + Intergenic
1178378240 21:32086114-32086136 GAGGATAAACAGCAGGTGGGAGG - Intergenic
1178585939 21:33870868-33870890 CTTGAGAGACAGCAGGTAGATGG + Intronic
1179479929 21:41670532-41670554 CTGCAGCAACAGGAGGTGGAGGG + Intergenic
1180602719 22:17033035-17033057 CAGAAGAAACAGCAGGTACAAGG + Intergenic
1180727101 22:17954377-17954399 CAAGAGGAACATCAGGGGGAAGG + Intronic
1180916859 22:19494817-19494839 CAGGGGGAACATCAGCTGGATGG - Intronic
1181342697 22:22195565-22195587 CAGAAACACCAGCAGGTGGAGGG - Intergenic
1181778150 22:25174652-25174674 CAAGACACACAGCAGGTGTATGG - Intronic
1182015790 22:27038648-27038670 CAGAGGAAACAGCAGGTGCAAGG + Intergenic
1182044545 22:27264100-27264122 CAGAGGAGACAGCATGTGGAAGG + Intergenic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1182444212 22:30380775-30380797 CAGGAGGAAGTGCAGGAGGATGG - Intronic
1182454063 22:30438652-30438674 CAGGAGAAACACCAGATCTAAGG - Intergenic
1182765998 22:32759126-32759148 CAGAAGCAAGAGGAGGTGGAAGG + Intronic
1183457321 22:37929944-37929966 AAGGACACACAGCAGGTGGGAGG - Intronic
1183961341 22:41413610-41413632 GAGGAGAAAAAGGAGGAGGAGGG + Intergenic
1184011884 22:41755025-41755047 CAGGAGGAACAGCAGCTGCAGGG + Intronic
1184040483 22:41940171-41940193 AAGGAGGAACAGCAAGTGCATGG - Intronic
1184368975 22:44070600-44070622 GAGGAGAAACCAGAGGTGGAAGG + Intronic
1184526672 22:45027990-45028012 GAGGAGAAGGAGGAGGTGGAAGG + Intergenic
1185234770 22:49705352-49705374 CAGGAGAACCACGAGGAGGACGG + Intergenic
949146187 3:702299-702321 CAGTGCAAACAGCATGTGGAAGG - Intergenic
950005606 3:9689206-9689228 CAGTAGAGACAGCAGGAGCACGG - Intronic
950184300 3:10935590-10935612 CAGGAGATACAGCAGGTAGACGG - Intronic
950427370 3:12931736-12931758 CAGTAGCTCCAGCAGGTGGATGG + Intronic
951363766 3:21755484-21755506 CAGTAGAGAGAGCAGGTGAAAGG - Intronic
952843502 3:37667816-37667838 CAGGAGAAACACCTGGTGGGAGG + Intronic
953450476 3:43001275-43001297 CAAGAAAAGCAGCAGCTGGAAGG - Intronic
953899679 3:46832991-46833013 CAGGAGAATTTCCAGGTGGAAGG - Exonic
954299821 3:49694878-49694900 CAGGAGAGACAGCAGGTGGTAGG + Intronic
954409611 3:50364723-50364745 CAGGAGGAGCAGCAGTTGCAGGG + Exonic
954660461 3:52224274-52224296 CAGGAGAGACAGCGGGTGCAGGG + Exonic
954699781 3:52445199-52445221 AAGGAGAAGCGGCAGGTGGACGG - Intergenic
954798206 3:53172210-53172232 CAAGAGGAACAGGAGGTGGGAGG - Intronic
954971138 3:54652629-54652651 CAGGAGGAAGTGCAGGTGGCTGG + Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
956806767 3:72821978-72822000 CAGGAGAGCCAGGAGTTGGATGG - Intronic
956874146 3:73445334-73445356 TAGGAGAAGCAGGAGTTGGATGG + Intronic
956925332 3:73980875-73980897 CAGAAGAAAAAGCAGGTTAAGGG + Intergenic
957269061 3:78005032-78005054 CTGGAAAAACAGCCAGTGGATGG + Intergenic
957382945 3:79457702-79457724 CAGGTGAAAGAGCATGTGCAGGG - Intronic
958736545 3:98016031-98016053 CAGGAGAGAGAGCATGTGCAGGG + Intronic
959040286 3:101414520-101414542 CAGGTGAAGCAGCAGCTGGACGG + Intronic
959274227 3:104257355-104257377 CAGAAGAACCAGCAGGAGCAAGG + Intergenic
959537573 3:107503961-107503983 AAGGAGAAAAAGCAGGTTGCTGG + Intergenic
959934107 3:112012093-112012115 CAGGAGAAACAGAACCTGGGTGG - Intronic
960954536 3:123022615-123022637 CAGGAGAGAAAGCAGAAGGAGGG - Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961465699 3:127079826-127079848 ACGGAGAAACAGCAAGTGCAAGG - Intergenic
961521030 3:127467461-127467483 CAGGAGGAAGGGGAGGTGGATGG - Intergenic
961530006 3:127534828-127534850 CAGGAGAAAAAGCAAGTGGCAGG - Intergenic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
961719589 3:128884068-128884090 CAGGAGAGACAGCGGCTGTAGGG + Intronic
962381204 3:134899426-134899448 CAGAAGAAACAGCAGGGCGAAGG - Intronic
963504368 3:146165027-146165049 CAGAAGAAACAGGAAGTGCAAGG + Intergenic
963596728 3:147337002-147337024 CAGGAGAAGCTGCAGCTGCATGG + Intergenic
963627159 3:147688386-147688408 CAGGAGAAAAAGAAGCTAGAGGG + Intergenic
964000794 3:151769665-151769687 CAGGAGAGAGAGCAAGTGAAGGG - Intergenic
964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG + Intergenic
964553259 3:157908689-157908711 CAGGAAAAATTGGAGGTGGAGGG + Intergenic
964728718 3:159842664-159842686 CAGAAGGAATAGCAGGTGCAGGG - Intronic
964735349 3:159911680-159911702 CAGGAGAAAGAGCAGTTTTAGGG - Intergenic
965028609 3:163334793-163334815 CAAGAGAGAGAGCATGTGGAAGG + Intergenic
965647169 3:170896536-170896558 CAGGAGATACAGCAAGTGAGGGG - Intronic
965690053 3:171346148-171346170 CAGATGAAACAGCAGGAAGAAGG + Intronic
966542286 3:181105625-181105647 CAGGAGATACAAAAGGCGGATGG + Intergenic
966767747 3:183478308-183478330 TAGGAGACAAAGCAGGAGGAGGG - Intergenic
968382688 4:109185-109207 CAGAAAACACAGCAGGTGCAGGG - Intergenic
968403237 4:316720-316742 CAAAAGGAACAGCAGGTGCAGGG + Intergenic
968666637 4:1825959-1825981 CAGGAGAAACAGCAGGTGGCAGG - Intronic
968843527 4:3025979-3026001 CAGGAGGCACAGCAGACGGACGG - Intronic
969006136 4:4021336-4021358 CAGCAGCAGCAGCAGCTGGAGGG + Intergenic
969086000 4:4656901-4656923 CAGGAGGAACGGCAAGTGGGAGG - Intergenic
969093224 4:4712518-4712540 CAGGACATACAGCAGGAGCAAGG + Intergenic
969723094 4:8904143-8904165 GAGGAGAAGCAGCAGGTCGAGGG - Intergenic
969806812 4:9615954-9615976 CAGCAGCAGCAGCAGCTGGAGGG - Intergenic
970029374 4:11658188-11658210 AAGGAGGAACGGAAGGTGGAAGG + Intergenic
970430371 4:15983561-15983583 CAGAAGAAACGGCATGTGCATGG + Intronic
970518745 4:16861795-16861817 CAGGGGGAACAGCATGTGCAAGG - Intronic
970786795 4:19806977-19806999 CAGAAGAACCAGCAGGTATAAGG - Intergenic
971195013 4:24464834-24464856 CAGGAGAAACATGCGGTGGAGGG - Intergenic
972016853 4:34257562-34257584 CATGAGAAACAGCAGTTTGAGGG + Intergenic
972408107 4:38765771-38765793 CAAGAGAAAACGCAGCTGGATGG - Intergenic
973014367 4:45119042-45119064 CAGGAGGAACAGCATGAGGGAGG + Intergenic
974855144 4:67452426-67452448 CAGGAGAAAGAGAAAGTGAAGGG - Intergenic
974925305 4:68291450-68291472 CAGGCAAAACAGCATGTGCAGGG + Intergenic
975306939 4:72860680-72860702 CAGTAGACACAGCAGGCAGATGG - Intergenic
975772490 4:77742168-77742190 CAGGAGAGAAAGCATGTAGATGG - Exonic
975788574 4:77922289-77922311 CAGAAGAAACAGCAAATGCAAGG + Intronic
976429370 4:84945192-84945214 CATGAAAACCACCAGGTGGAAGG + Intronic
976997084 4:91447389-91447411 AAGGAGAAATAGCAGGTTTAGGG - Intronic
977475292 4:97499786-97499808 CAGCAGAAACAGCTAGTGCAAGG + Intronic
977785047 4:101023036-101023058 CAGGAAAAACAGCTGATGCAGGG + Intergenic
978405165 4:108371379-108371401 GAGGAGCAACAGCAGATGAATGG - Intergenic
978553279 4:109950742-109950764 GAGGAGAGACAGCTGGTGAAGGG - Intronic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
979150275 4:117304485-117304507 CAGGTGAAAGAGAAGGTGAAAGG + Intergenic
979293085 4:118999702-118999724 CAGGAGAATAATCAGGTGAAGGG + Intronic
979577622 4:122313670-122313692 CAGGACAAGCAGCAGCTGGTAGG + Exonic
979783087 4:124680818-124680840 CAGGAGAAATAGCTGGGGGTAGG + Intronic
981497712 4:145412260-145412282 CAGAAGAAACAGCTAGTGCAAGG - Intergenic
982255452 4:153447057-153447079 AAGGAGAAGCAGGAGGTTGATGG - Intergenic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
984521045 4:180801294-180801316 CTTGAGAAACAGCAGCTGGAAGG + Intergenic
985239121 4:187910920-187910942 CAGCAGCAACAACAGGTGCAGGG + Intergenic
985493057 5:190312-190334 AAAGAGAAACAGCAGTGGGAGGG - Intergenic
985884729 5:2668777-2668799 GAGGAGTAACAGCAGGTGCGAGG - Intergenic
986123161 5:4861043-4861065 CAGGAGAAGCAATAGGTGAAAGG + Intergenic
986308856 5:6536334-6536356 CAGGGAAAACAGCAGGTCCAGGG - Intergenic
986455104 5:7910791-7910813 CTGGAGAAACACCAGGTTGATGG + Intergenic
986583230 5:9287107-9287129 CTGGAGGAAGTGCAGGTGGACGG - Intronic
986585179 5:9309052-9309074 CAGAAGAAAGAGTAAGTGGAAGG + Intronic
986813166 5:11381527-11381549 CAGGAGGAACAGCAAGTTCAAGG - Intronic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
987032876 5:13991569-13991591 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
987062367 5:14254644-14254666 GAGAAGAAACAGGAGGAGGAGGG - Intronic
988578136 5:32445609-32445631 CAGGAAGAGCAGCAAGTGGAAGG + Intergenic
988836072 5:35033559-35033581 GAGAAGAAACAACAGGAGGATGG + Intronic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
989087877 5:37695157-37695179 CAGGAGTAAGAGAAGGGGGAGGG + Intronic
991006681 5:61834690-61834712 CAGGAAAATTAGCAGATGGATGG + Intergenic
993061202 5:83041217-83041239 AATGAGAAACAACATGTGGATGG - Intergenic
993200933 5:84813800-84813822 CAGGAAAGACAGCATGTGCAGGG - Intergenic
993390837 5:87318547-87318569 CAGGAGAAACAGCATGTGAAGGG + Intronic
993813154 5:92508637-92508659 CAGGAGCAAGAGCATGAGGAGGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
995165405 5:109034146-109034168 CAGCAGAAACAGGAGGTGTGAGG - Intronic
996037193 5:118771586-118771608 CAAGAAAAACAGCATGTGCAGGG + Intergenic
997022239 5:130015168-130015190 CAGGAGAGACAGAAAGTGAAGGG - Intronic
998189495 5:140011006-140011028 CAGGACAAACAGTAGTGGGAGGG - Intronic
998522916 5:142816975-142816997 GAGGAGAGAGAGCACGTGGATGG + Intronic
999068544 5:148717497-148717519 CAGGAGAGGCAGAAGGTGAAGGG - Intergenic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
1000230376 5:159310357-159310379 CAAGAGAAACAACACCTGGAAGG - Intergenic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000537132 5:162493126-162493148 CAGGAGAAATAGCATGGGAATGG + Intergenic
1000713994 5:164617595-164617617 CAGGAGAAATAGCAGGAAAAGGG + Intergenic
1000895047 5:166845343-166845365 AAAGAGAGACAGCAGGTTGAGGG + Intergenic
1001310033 5:170603932-170603954 AGGGAGAAACAGGAGGTGGAGGG + Intronic
1002190664 5:177475815-177475837 CAGGGGCAACAGCAGCTGAAAGG - Intergenic
1002267229 5:178043795-178043817 CATGAGAAACAACAGATTGAAGG - Intronic
1002971101 6:2021035-2021057 CAGGAGAAGCAGCTGGGAGAAGG - Intronic
1003083907 6:3045687-3045709 CAGGTGAAGCAGCAGCTGGACGG + Intergenic
1003315853 6:5011350-5011372 AAAGAGACACAGCAGGAGGAAGG + Intergenic
1004278498 6:14258882-14258904 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005440588 6:25863766-25863788 CAGGAGAAATAGCAGGGAGCTGG + Intronic
1005646919 6:27848265-27848287 TAGGAGAAAAAGCAGGAGGAGGG - Intronic
1005696532 6:28357000-28357022 CTCGAGAGACAGCAGGTAGATGG + Intronic
1005763267 6:28987029-28987051 CAGGAGAAAGAGCAGGGGGGCGG + Intergenic
1005921528 6:30406213-30406235 CAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1006888326 6:37400765-37400787 CTGGAGAAAATGCAGCTGGATGG + Intergenic
1007071868 6:39043828-39043850 GAAGAGAAGCAGGAGGTGGAGGG + Intergenic
1007183941 6:39951451-39951473 CAGGAGAAACAGCAGGGATATGG - Intergenic
1007216960 6:40247871-40247893 CAGGTGAGACAGCAGGAGCAAGG - Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007478683 6:42135974-42135996 CAGGAAAAACAAGAGATGGAGGG - Intronic
1007510544 6:42371330-42371352 AAGGAGACACAGCAGATGAAAGG - Intronic
1007871263 6:45041682-45041704 AAGAAGAAAAAGAAGGTGGAAGG - Intronic
1008101614 6:47397855-47397877 CAGAAGAAAAAGAAGATGGAGGG + Intergenic
1008231620 6:48990311-48990333 CAGGACTACCAGCAGTTGGAAGG + Intergenic
1008750964 6:54733431-54733453 CATGAGAAACAGCAAGAGGAAGG + Intergenic
1008970636 6:57363844-57363866 GAGGAGAAAGAACAGGTAGAGGG - Intronic
1009159599 6:60265653-60265675 GAGGAGAAAGAACAGGTAGAGGG - Intergenic
1009260043 6:61474556-61474578 CAGGATAAAAAGCAGAAGGAAGG + Intergenic
1010346217 6:74814355-74814377 CAGGAGAAACTTCTGCTGGAGGG + Intergenic
1011626029 6:89284609-89284631 CAGGAGCCACAGAATGTGGACGG + Intronic
1013073756 6:106752375-106752397 CAGGAGACACAGCAGAGGGATGG - Intergenic
1013551679 6:111213794-111213816 CAGGCCACACAGCAGGTGGCTGG - Intronic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1015785743 6:136921180-136921202 CAGGACAACCGGCAGGCGGAGGG - Intergenic
1016095882 6:140036581-140036603 CAGGAGAAGCAGCAGAAGAAAGG - Intergenic
1016933765 6:149433609-149433631 AAGGACACACAGCAGGTGGTAGG + Intergenic
1017006080 6:150028875-150028897 CTGGAGAAAGAGCAGGTGGGTGG + Intergenic
1017484354 6:154889400-154889422 CAGGAGAAACAGGGCTTGGATGG + Intronic
1018578901 6:165290433-165290455 CATCAGACACAGCAGGAGGAAGG + Intronic
1019039909 6:169095221-169095243 CAGGAGCAACTTCTGGTGGATGG - Intergenic
1019168742 6:170116843-170116865 CAGGAGGAAGAGCAGGAGGCTGG + Intergenic
1019192591 6:170261851-170261873 ATGGAGAATCAGCAGGTGCACGG + Intergenic
1021759106 7:23886032-23886054 CAGGAGGAACAGCAAGTGGAAGG + Intergenic
1021951914 7:25783280-25783302 TAGGAGAAGCAGCAACTGGAAGG - Intergenic
1022029470 7:26479173-26479195 CAGAACAAACAGCAAGTGCAAGG - Intergenic
1022036148 7:26536842-26536864 CAAGAGAAGCAGCAGTTGGCAGG + Exonic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022254027 7:28637660-28637682 CAGAAGAAACAACAGGACGAAGG + Intronic
1022466102 7:30654049-30654071 CAGGAGGTAGAGAAGGTGGAGGG - Intronic
1023074881 7:36472771-36472793 CTTGAGAGACAGCAGGTAGATGG + Intergenic
1023608731 7:41953714-41953736 CAGAACTAACAGCAGGTGGATGG + Intergenic
1023741197 7:43282259-43282281 CAGGAGGAAAGGCAGGTGGCAGG + Intronic
1027267480 7:76502410-76502432 CAGGAGGCACAGCAGGTGGAAGG - Exonic
1027319295 7:77002275-77002297 CAGGAGGCACAGCAGGTGGAAGG - Intergenic
1027463513 7:78485516-78485538 AAGGAGAAACAGGACATGGATGG - Intronic
1029110943 7:98212769-98212791 CAGCAGCAGCAGCAGGTGGCTGG + Exonic
1029189466 7:98761487-98761509 CAGGGGAAACAGCCAGTGCAAGG + Intergenic
1029441381 7:100588648-100588670 CAGGAGAAACAGCAGGGGTCAGG - Intronic
1030148816 7:106382401-106382423 GAGGAGAAAGAGGAGGCGGAGGG + Intergenic
1030247688 7:107402702-107402724 CAGGAAGAGCTGCAGGTGGATGG + Intronic
1030545655 7:110892079-110892101 GTTGAGAAACAGGAGGTGGAAGG - Intronic
1030727391 7:112941077-112941099 CAGGAGAAGCGGGAGGTGAAGGG + Intergenic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031649840 7:124275281-124275303 AAGGAGAAACAGGAAGTTGATGG + Intergenic
1032159668 7:129501015-129501037 GAGAAGAAAGTGCAGGTGGAGGG + Intergenic
1032418648 7:131759490-131759512 CTGGAGAAAGAGCAGGGGAAAGG - Intergenic
1032435241 7:131895467-131895489 CAGGAATAACAGCAGGTGTAGGG + Intergenic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1032640452 7:133760561-133760583 CAAGAGAAAGAGCAGGTGCCAGG - Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034691341 7:153016584-153016606 AAGGAAAAACATCAGGCGGACGG - Intergenic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1034896753 7:154881220-154881242 CAAGAGCTACAGCAGATGGATGG - Intronic
1035274424 7:157738936-157738958 CAGGAGACAGAGCACCTGGAAGG + Intronic
1035575355 8:701144-701166 CTGGAGAAGAACCAGGTGGACGG + Intronic
1035953789 8:4053415-4053437 CATGATAAAAAGCAGGTGGTGGG - Intronic
1035988108 8:4456909-4456931 CAGGATAAACAGTTGGTGGGTGG - Intronic
1036098178 8:5748386-5748408 GAGGAGATACAGCAGGTGTACGG + Intergenic
1037432934 8:18832774-18832796 CAGGCAAAAGAGCAGGTGCAGGG + Intronic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1038097681 8:24333595-24333617 CATGAGAAACAGCAGCAGGTAGG - Intronic
1038145141 8:24888391-24888413 CAGGGGAAACAGCAGGTGATGGG + Intergenic
1038240807 8:25806603-25806625 CAGGAGAGAGAGCACGTGCAGGG - Intergenic
1038269793 8:26065945-26065967 CAGGAGAGACTGTAGGGGGATGG - Intergenic
1038779211 8:30556504-30556526 CAGGAGACACAGGAGGGGGAGGG - Intronic
1039231517 8:35453927-35453949 TAGGAGAAATAGCAGGGGGTAGG - Intronic
1039884235 8:41646296-41646318 GAGGAGGAGCAGCAGGTGCAGGG - Exonic
1039888395 8:41668573-41668595 CAGAAGAAGCAGCAGATGGCCGG + Intronic
1040097137 8:43456946-43456968 CAGGAGAAAAAGCTGGCAGAAGG - Intergenic
1040509221 8:48078759-48078781 CAGCTGAAACATCAGGTAGAAGG + Intergenic
1040879312 8:52188376-52188398 CAGCAGAAACAGCAGGTGCAAGG + Intronic
1041269117 8:56093676-56093698 CAGCAGAAAGAGCAGATGGAGGG - Intergenic
1041390958 8:57347227-57347249 CAGGAGAGACAGCTGGCGGCAGG - Intergenic
1041523822 8:58784020-58784042 CAGCAAAAACAACAGGTGGCAGG + Intergenic
1041928552 8:63263675-63263697 CAGCAGAAGCAGCTGGTGGATGG + Intergenic
1042505783 8:69558344-69558366 CAGTTGAAACAGCAGGGGCAGGG - Intronic
1042770265 8:72372895-72372917 CAGAAGAAACAGCATTTGCAAGG - Intergenic
1042995466 8:74693466-74693488 CAGAAGCCACAGCAGGTGGTGGG + Intronic
1044122115 8:88410841-88410863 GAGGAAACACAGAAGGTGGATGG + Intergenic
1044295287 8:90519806-90519828 CAGGAGAGACAGAGGGTGAAGGG - Intergenic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1045871425 8:106931945-106931967 CAGGAGAGAGAGCATGTGCAGGG + Intergenic
1047148186 8:122229878-122229900 CTGGAGTGAGAGCAGGTGGATGG + Intergenic
1047167686 8:122458420-122458442 CAGTGGAAACAGTGGGTGGAGGG + Intergenic
1047430798 8:124789818-124789840 CAGGAGATCCAGAAGGTGGCAGG - Intergenic
1047635468 8:126756868-126756890 CAGAGGAAACAGCACGTGCAGGG - Intergenic
1048179207 8:132179995-132180017 GAGGAGAAACAGGAAGTGGCGGG - Intronic
1048384370 8:133897899-133897921 CAGGAGAAACAGAATGTGTGAGG - Intergenic
1049139768 8:140942746-140942768 CAATAAAAACATCAGGTGGATGG + Intronic
1049190722 8:141285949-141285971 CAGGAGAACCAGCAGCGTGAAGG + Intronic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049580304 8:143407896-143407918 CCGGAGAAGAAGCAGGTGCACGG + Intergenic
1049884303 9:17336-17358 CAGCTGGAACAGCAGGTGGGAGG - Intergenic
1049997850 9:1048229-1048251 GAGGAGAAACAGGAGGAGAAAGG - Intergenic
1050042683 9:1512584-1512606 CAGAAGAAACAGCAGTTGGTTGG + Intergenic
1050815827 9:9810042-9810064 CAGGAGGAAGGGGAGGTGGAAGG - Intronic
1051229587 9:14941903-14941925 CAGGAGAATCTGCACCTGGAAGG + Intergenic
1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG + Intergenic
1051556090 9:18384250-18384272 CAGGAGAGACAGCGAGTGAAGGG + Intergenic
1051839425 9:21378631-21378653 CTGAAGAAAAAGCCGGTGGAAGG + Intergenic
1051845586 9:21448191-21448213 CTGAAGAAAAAGCTGGTGGAAGG - Intergenic
1052059180 9:23940049-23940071 CAGGAGAAACAGTAGGCCAAAGG - Intergenic
1052518307 9:29511301-29511323 CAAGAGAGAGAGCAGGTGCAGGG + Intergenic
1052777035 9:32742606-32742628 CAGGACAATCAGCAGGAGGCAGG + Intergenic
1052900820 9:33793576-33793598 CAGGAAGAAAAGCAGGAGGAAGG + Intronic
1052902362 9:33804271-33804293 CAGGAAGAAAAGCAGGAGGAAGG + Intergenic
1052983465 9:34466913-34466935 AGGGAGAACCAGCAGTTGGATGG - Intronic
1053283204 9:36834937-36834959 CAGGTGAAACAGCAGGGTGGGGG - Exonic
1053345280 9:37373536-37373558 CAGGAGGAGCAGCACGTGCAAGG + Intergenic
1053415533 9:37944834-37944856 CAGGAGAAGCTGCAGGGAGAAGG - Intronic
1054728423 9:68676292-68676314 CAGGAGAGGAAGCAGGTGGATGG - Intergenic
1054743088 9:68828200-68828222 CAGGAGAAACAGAAGAGGAAGGG - Intronic
1054878221 9:70118724-70118746 CTGGAGAAACAGCACGTAGAAGG + Intronic
1056559644 9:87718973-87718995 CAGGTCACAGAGCAGGTGGAGGG - Intergenic
1057026341 9:91736615-91736637 GAGTAGAGACAGCAGGAGGAGGG + Intronic
1057049436 9:91911765-91911787 CAGGAAAAACAGCAGCTTTAAGG + Intronic
1057080766 9:92172914-92172936 CAGGGGCACCAGCAGGTGCAAGG - Intergenic
1057167624 9:92941139-92941161 GAGGGAAAACAGCAGGGGGAAGG + Intergenic
1057226944 9:93297424-93297446 CAGGGGAAACAGACAGTGGAAGG - Intronic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1058263881 9:102873440-102873462 AAGACGAAACAGCTGGTGGAGGG + Intergenic
1058686871 9:107487939-107487961 TAGGTGAAGCTGCAGGTGGAGGG + Exonic
1058726882 9:107813058-107813080 CAAGAGAGACAGCATGTGCAGGG + Intergenic
1058901542 9:109446629-109446651 CTGGAGAAAGAGGAGGTGAATGG + Intronic
1058983502 9:110191431-110191453 CAGGCAAGACAGCAAGTGGAGGG - Intronic
1059320066 9:113462472-113462494 CATGGCCAACAGCAGGTGGAAGG - Intronic
1059426026 9:114221563-114221585 CATGAGAAATGACAGGTGGAAGG - Intronic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1060522249 9:124300486-124300508 CAGGTGAGACAGCAGGAGGCGGG + Intronic
1060667264 9:125439344-125439366 CAGGTCACACAGCAGGTGGGAGG - Intronic
1060741729 9:126103201-126103223 CAGAGGAGAGAGCAGGTGGAAGG - Intergenic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1061204814 9:129156750-129156772 CAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1061864613 9:133485842-133485864 CAGGAGGAACAGCAGGACAAGGG - Intergenic
1062352934 9:136148037-136148059 AAGGCCACACAGCAGGTGGAGGG + Intergenic
1062437087 9:136551137-136551159 GAGGAGAGACATCAGGAGGATGG + Intergenic
1062541728 9:137044555-137044577 CAGGAACAAGAGCAGCTGGACGG + Intronic
1062564522 9:137158256-137158278 CAGGAGAAGGAGCAGGGAGAAGG + Intronic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1185566605 X:1099730-1099752 CAGGAGAAGGAGTAGGTGAAGGG + Intergenic
1185834040 X:3328859-3328881 CAGGAGAGAAGGCAGGAGGAAGG + Intronic
1186042097 X:5492056-5492078 CAGGAGGAAGCGGAGGTGGAGGG - Intergenic
1186647586 X:11523766-11523788 AAGTAGAACCAGCAAGTGGAGGG + Intronic
1187718905 X:22131534-22131556 AAGAACAAACAGCAGATGGAAGG - Intronic
1188632817 X:32389057-32389079 AAGGACAAACAGCTGGTGAATGG - Intronic
1188962008 X:36503393-36503415 CAAGAGAGACAGCATGTGCAGGG + Intergenic
1189066245 X:37812362-37812384 AAGGAGAAAGAGCTGGGGGAAGG + Exonic
1189288097 X:39866409-39866431 CAGGAGAGGCAGGAGGTGGGAGG + Intergenic
1189668978 X:43387642-43387664 CAGGAGCAAGAGAAAGTGGAAGG - Intergenic
1190311800 X:49122272-49122294 CAGGAGAAGGGGCAGGTGGCGGG + Intronic
1190389047 X:49913287-49913309 AAGGAGAAACAGCAGTTAGGAGG + Intergenic
1191263421 X:58355068-58355090 CAGGATAAAAAGTAGGTGGAAGG + Intergenic
1191836619 X:65470205-65470227 GTGGAGAAAAAGGAGGTGGAGGG + Intronic
1192551613 X:72059126-72059148 CTGGAAAACCAGCAGGTGCAGGG - Intergenic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1194711175 X:97238068-97238090 CAGAAGAGACAGCAGGGGAAGGG + Intronic
1194950146 X:100116013-100116035 CAGAAGAAAAAGCAGCTGAAAGG + Intergenic
1195067505 X:101250817-101250839 CAGGAGAACCAGCAGGGGCTGGG - Intronic
1196465623 X:115969091-115969113 CAGGAGACACAGAAGATGGAGGG - Intergenic
1196569512 X:117249065-117249087 CAAGGGAAATAGGAGGTGGAGGG - Intergenic
1196779891 X:119374461-119374483 CAGAAGAAACTGCATGTGCAAGG + Intergenic
1197440112 X:126477130-126477152 CTGGAGAAAGAGAAGGTGAAGGG + Intergenic
1197734478 X:129840682-129840704 CTTGAGTAACAGCAGGGGGAGGG - Intronic
1197889549 X:131255590-131255612 CAGGAGAAACAGGTGGTATATGG - Intergenic
1199785868 X:151104344-151104366 CAGCAGGAAGAGCAGGTTGAGGG - Intergenic
1199862791 X:151816871-151816893 TAGGAGAAAGAGCAGGAGAAAGG - Intergenic
1199901516 X:152177217-152177239 CAGTTAAAACAGGAGGTGGACGG + Intronic
1200092584 X:153642793-153642815 CAGGAGACACGGGAGGTGCACGG - Intronic
1200310955 X:155076672-155076694 CAGGAGAGACACCTGGTGAAAGG - Intronic
1200401502 X:156022820-156022842 CAGCTGGAACAGCAGGTGGGAGG + Intergenic
1201868068 Y:18676256-18676278 GTGTAGAAACAGCAGGTGTATGG - Intergenic