ID: 1081521938

View in Genome Browser
Species Human (GRCh38)
Location 11:43890308-43890330
Sequence CTGAGCTTGTAAAAGTGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081521935_1081521938 10 Left 1081521935 11:43890275-43890297 CCAGTCTCCTCTAGCTTCAGCAT 0: 1
1: 0
2: 1
3: 15
4: 257
Right 1081521938 11:43890308-43890330 CTGAGCTTGTAAAAGTGACACGG 0: 1
1: 0
2: 0
3: 15
4: 189
1081521934_1081521938 20 Left 1081521934 11:43890265-43890287 CCAGAAGAGTCCAGTCTCCTCTA 0: 1
1: 0
2: 0
3: 11
4: 116
Right 1081521938 11:43890308-43890330 CTGAGCTTGTAAAAGTGACACGG 0: 1
1: 0
2: 0
3: 15
4: 189
1081521936_1081521938 3 Left 1081521936 11:43890282-43890304 CCTCTAGCTTCAGCATCTGTACT 0: 1
1: 0
2: 1
3: 13
4: 179
Right 1081521938 11:43890308-43890330 CTGAGCTTGTAAAAGTGACACGG 0: 1
1: 0
2: 0
3: 15
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081521938 Original CRISPR CTGAGCTTGTAAAAGTGACA CGG Intronic
900499965 1:2999406-2999428 CTGAGCTTGCAAAAGAGTAATGG - Intergenic
903471850 1:23592820-23592842 ATGAGGCTGGAAAAGTGACAGGG + Intronic
904017519 1:27434082-27434104 CTGAGAATATAAAAGTTACAGGG + Intronic
906120744 1:43389009-43389031 CTGAGCTTGTGAAAGAGGCACGG - Intronic
910241315 1:85089348-85089370 TAGAGCTTGGAAAAGTCACAGGG - Intronic
911267587 1:95761752-95761774 CTGAGCCTGTAAAAATCAAAAGG + Intergenic
913365206 1:118030239-118030261 CTGGCCTTGTAAAAGTTACAAGG - Intronic
914825720 1:151137032-151137054 CCGAGTATGTAAACGTGACATGG - Exonic
915007465 1:152652786-152652808 CTGAGCCTGTAGCAGAGACATGG - Intergenic
915231390 1:154448180-154448202 CTGTTCTTGTAAAAGGGTCAGGG + Intronic
916662808 1:166937504-166937526 CTGAGCTTGGATAAATGGCAAGG + Intronic
918881505 1:190129318-190129340 GTTATCTTTTAAAAGTGACATGG + Intronic
918947537 1:191088200-191088222 CTGAGCTAGAAAAAGTGATTTGG - Intergenic
919726643 1:200888749-200888771 CTGAGCTTCTAAAAGCTGCATGG - Intergenic
919761040 1:201098389-201098411 CTGGGTTTGTCAAAGTCACATGG + Intronic
920383647 1:205551094-205551116 CTTAGCATGAAAAAGAGACAAGG + Intergenic
923583476 1:235241843-235241865 TTAAGCTTTTTAAAGTGACATGG + Intronic
924202808 1:241677501-241677523 CTGAGCATGTAAAAGAAACAAGG + Intronic
1062839630 10:660126-660148 CAGAGCTTGAAACAGGGACAAGG - Intronic
1062839634 10:660171-660193 CAGAGCTTGAAACAGGGACAAGG - Intronic
1062839643 10:660261-660283 CAGAGCTTGAAACAGGGACAAGG - Intronic
1062839647 10:660306-660328 CAGAGCTTGAAACAGGGACAAGG - Intronic
1062839657 10:660396-660418 CAGAGCTTGAAACAGGGACAAGG - Intronic
1062839663 10:660441-660463 CAGAGCTTGAAACAGGGACAAGG - Intronic
1062839667 10:660484-660506 CAGAGCTTGAAACAGGGACAAGG - Intronic
1063761888 10:9088238-9088260 CTGATCTTGTAAGAGTGTCTGGG - Intergenic
1066258477 10:33705067-33705089 CTGAGCTTGAAAAATTGTCTTGG - Intergenic
1066721015 10:38339112-38339134 AAGAGCTTGTAAATTTGACAAGG - Intergenic
1068825077 10:61427782-61427804 CAGAGCACATAAAAGTGACAGGG - Intronic
1069087307 10:64156241-64156263 CTCAGCTTGTCCAAATGACAAGG - Intergenic
1070438589 10:76418681-76418703 CTGAGATTGAAAATGAGACAAGG - Intronic
1073553487 10:104425784-104425806 GTGACTTGGTAAAAGTGACAAGG + Intronic
1076008329 10:126966058-126966080 CTGAGCTTATAGAAGTAAAAAGG - Intronic
1077235172 11:1478508-1478530 CTGGGTTTCTAAAAGTGCCACGG + Intronic
1079237885 11:18702548-18702570 CTGAGATTGTTCAAGTAACAAGG - Exonic
1081521938 11:43890308-43890330 CTGAGCTTGTAAAAGTGACACGG + Intronic
1082128078 11:48455700-48455722 CTAAGCTTGGAAAATTCACAGGG - Intergenic
1082561632 11:54626628-54626650 CTAAGCATGGAAAAGTCACAGGG - Intergenic
1083581566 11:63828434-63828456 CTGAGCTTTCTAAAGTGAAATGG + Intergenic
1086363683 11:86086700-86086722 CTGAGCTTGAGGATGTGACAAGG - Intergenic
1086392577 11:86380663-86380685 CTGAGCTTGAAGATGTGACAAGG - Intronic
1087966672 11:104423242-104423264 CTGTGTTTGTAAAAGGAACAGGG + Intergenic
1091136769 11:133198309-133198331 CTGAGTTTTAAAAAGTGAAATGG + Intronic
1092063083 12:5566465-5566487 CTAAGCCTGGAAAAATGACAAGG + Intronic
1094030601 12:26007576-26007598 CTGAGTTTGTAAAGGTGAGTGGG + Intronic
1095268110 12:40183642-40183664 CAGAGATCGTAAAACTGACAAGG + Intergenic
1095403387 12:41840593-41840615 CTCTCCTTGTAAAAGTGCCAAGG + Intergenic
1098000176 12:65933063-65933085 CTGAACTTCTCAAAGTGATAAGG - Intronic
1099724060 12:86401874-86401896 CTACACTTGGAAAAGTGACATGG + Intronic
1101288809 12:103344873-103344895 CTGAACTGGGAGAAGTGACATGG + Intronic
1102809265 12:115809838-115809860 CTGAGCTGGTAAACATCACATGG - Intergenic
1106960222 13:34989686-34989708 CTGTGCTTTGAAAGGTGACAAGG - Intronic
1108757552 13:53522250-53522272 CTGTGGTTGTGAAAGTGAAAGGG + Intergenic
1109814997 13:67569812-67569834 CTGGCCTTGTAAATGTGAAAGGG - Intergenic
1110553944 13:76837296-76837318 CTAAGGTAGTAAAACTGACAAGG - Intergenic
1118767183 14:68917583-68917605 GTGGGCTTTTAAAAGTGAAATGG - Intronic
1121684304 14:95821671-95821693 CTGTCCTTGTGATAGTGACAGGG + Intergenic
1123711605 15:22991921-22991943 CTGAGGTTGTACTAGTGATAGGG + Intronic
1123957385 15:25351817-25351839 CTAACTTTGAAAAAGTGACAAGG - Intronic
1125149768 15:36518706-36518728 CTGAGAGTGCAAAAGAGACAGGG + Intergenic
1125167700 15:36728215-36728237 CTGGAATTGAAAAAGTGACAAGG + Intronic
1125413885 15:39432343-39432365 CTGAGCTTGTAAAAGATCCCTGG - Intergenic
1127372090 15:58350816-58350838 CCCAGCTTCTGAAAGTGACATGG + Intronic
1128776930 15:70327838-70327860 CTGGGCTTGCTAAAGTGGCAGGG - Intergenic
1130300344 15:82675832-82675854 CTGAGCTTTTCAAGGTGTCAGGG - Intronic
1135469792 16:22719998-22720020 CTGAATTTGCAAACGTGACATGG - Intergenic
1137604635 16:49779373-49779395 CTGAGCTTCAAAAAATGCCAAGG + Intronic
1138327505 16:56188077-56188099 CTGAGTTGGTAAAAGTAAGATGG + Intergenic
1138402037 16:56754344-56754366 CTGTGCTTTGAAATGTGACAAGG - Intronic
1139286997 16:65824448-65824470 CTGATTTAGTAAAAATGACATGG + Intergenic
1140094296 16:71861771-71861793 CTGACCTGTTAAAAGTGGCATGG + Exonic
1140259144 16:73362254-73362276 CTGAGTTTGCAAACGGGACATGG + Intergenic
1140813630 16:78601098-78601120 CTCAGGGTGTATAAGTGACATGG + Intronic
1140924979 16:79573798-79573820 CTTAGTCTGCAAAAGTGACAAGG + Intergenic
1141343343 16:83223588-83223610 CTGAGCTTGGCAAAGTCACCTGG - Intronic
1146697620 17:34921920-34921942 CTGAGCTTAAAAAAGAGAAAGGG + Intergenic
1146728494 17:35174515-35174537 ATCAGCTTTGAAAAGTGACATGG + Intronic
1147724376 17:42557390-42557412 ATGATCTTTTAAAAATGACAGGG + Intergenic
1149240790 17:54646358-54646380 CTGAGATCTTAAAAGAGACAGGG + Intergenic
1149899411 17:60459976-60459998 CTGAGCTTGCAAGAGTGAGGGGG - Intronic
1151445415 17:74160517-74160539 CTGAGCTAGTGAAACTCACAGGG + Intergenic
1152904262 17:82961699-82961721 CTGAGCTTGGACAAGTGAGCAGG - Intronic
1155146336 18:23086742-23086764 CTGGGCTTGGAAAGATGACAAGG - Intergenic
1156568559 18:38224235-38224257 CTGAGCTTTGAAAATTGAGAAGG - Intergenic
1159513751 18:69430993-69431015 CTGAGCTAGGAAAATTGACATGG - Intronic
1160168544 18:76533613-76533635 CTGCCCTGGTAAAAGTGAAATGG + Intergenic
1162177550 19:8842395-8842417 TTGAGCATTTAAGAGTGACAAGG + Intronic
1162427022 19:10602871-10602893 CTGGGCTCGGAAAAGAGACAGGG + Intronic
926419589 2:12683574-12683596 CTTCGTTTGTAAAAGTAACAAGG - Intergenic
926716856 2:15931387-15931409 CTGTCACTGTAAAAGTGACATGG + Intergenic
929179526 2:39020661-39020683 GTGAACTTGTAAAACTGAAATGG - Intronic
932830429 2:74984660-74984682 CATAGTTTGTAAAAGTGAGAAGG + Intergenic
939126828 2:138187556-138187578 CAGAACTTGCAAAAGTGCCAAGG - Intergenic
939859432 2:147400027-147400049 GTGAGCTTGGACAAGTGACAGGG - Intergenic
942164729 2:173231045-173231067 CTGAGCTTGTTAAATAGACCTGG - Intronic
942166292 2:173244054-173244076 CTGAGCCTGTGACAGTGCCATGG + Intronic
944989678 2:205221281-205221303 CTGAGGTTGTAAAAGGAGCAAGG - Intronic
947192471 2:227521656-227521678 CTGAATTGGTAAAAGTAACACGG - Intronic
947584414 2:231344657-231344679 CTGGGTTTGTAAAAATGAGAAGG - Intronic
947917360 2:233841775-233841797 CTGAGCCTGTGAAAGGGACAGGG - Exonic
948148644 2:235727490-235727512 GTGAGACTGTAAAAGTCACAAGG - Intronic
948229756 2:236341415-236341437 GTGTGTTTGTAAAAGTGGCAGGG + Intronic
948638653 2:239359348-239359370 CTGTGCGTGTAAAAGTGAGGAGG - Intronic
1168806131 20:673337-673359 CTGAGCTTGTCAAAGTTGGAAGG + Intronic
1169717638 20:8638333-8638355 TTGAGATTGTAGAGGTGACAGGG + Intronic
1170871683 20:20212153-20212175 CTGAGCTGTTAGAAGTCACATGG - Intronic
1171034226 20:21703395-21703417 CCGAGCTTGGAAAAGTGGCAAGG - Intergenic
1173123401 20:40314867-40314889 CTGAGGTTGTAAAAGTGCAAAGG - Intergenic
1173601403 20:44298031-44298053 CTGAGCTGGTGACAGTGTCAGGG + Intergenic
1174847099 20:53953248-53953270 CTCAGCTTGTAAAATGGAGAAGG + Intronic
1182602534 22:31477803-31477825 CTTGGGTTGTAAAAGTGGCAGGG + Intronic
1182751122 22:32643022-32643044 ATGAGCTTATAAAAGTGATAGGG + Intronic
1183901180 22:41007259-41007281 GTGAGCTAGGGAAAGTGACAGGG - Intergenic
1184782696 22:46657100-46657122 CTGAGCCTGTCAAGGAGACAGGG + Intronic
949410201 3:3755220-3755242 GTGAGCTTGTAAAACTGCTAAGG - Intronic
949875809 3:8625347-8625369 CTGAGTGTGTAAAAGTCAAAAGG + Intronic
950330869 3:12155138-12155160 CTGAGGTTCTAAAAGAGGCATGG - Intronic
952859278 3:37799425-37799447 ATGAGCTTGTCAAATGGACAAGG + Intronic
954886921 3:53882714-53882736 CTGAGATGGTGAAAGTGAGAGGG - Intergenic
955525087 3:59811872-59811894 CTGTGATTGTGAAGGTGACAAGG + Intronic
956456754 3:69429089-69429111 CTGACCTTTAAAAAGTGTCAGGG - Intronic
957005354 3:74939261-74939283 ATGTGCTTGTAAAAGTTACTAGG + Intergenic
958915720 3:100048008-100048030 CATAGCTTGTGAAAGTGAAAGGG + Intronic
960794840 3:121474404-121474426 CTGAGCTTGTGAGTGTTACATGG - Intronic
962337671 3:134550918-134550940 CTGGGCTGGTAAAAATGACTGGG + Intronic
962404088 3:135085513-135085535 CTGAGATTGTAAAGATGCCAAGG + Intronic
967196209 3:187028028-187028050 CTGATCTTGTCAGAGTCACAAGG - Intronic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
975115598 4:70677115-70677137 CTAAGCTTGTACAATTGAAATGG - Intronic
976139005 4:81970971-81970993 AAGAGCTTGGAAAAGTGTCATGG - Intronic
976356295 4:84121516-84121538 CAGAGCTAGTAAAAGGGAAAAGG - Intergenic
977408737 4:96634225-96634247 CATAGCTTTTAACAGTGACAGGG + Intergenic
979671168 4:123361433-123361455 CTGGGCTTGATAAAGTGACATGG + Intergenic
981096958 4:140791909-140791931 CTCAGATTGTCAAAGTGGCAGGG - Intergenic
982850072 4:160302981-160303003 CTGACCTTATGAAAGTGAAAAGG - Intergenic
984901324 4:184589257-184589279 CTGAGATTTTAAAAGTCAGATGG - Intergenic
987285380 5:16450885-16450907 GTGACCTTGGAAAAGTGACTTGG - Intergenic
988837050 5:35044047-35044069 ATGAGATTGCAAATGTGACAAGG - Intronic
989265648 5:39470623-39470645 ATTAGCTTGTAAATTTGACAGGG + Intergenic
991456442 5:66809344-66809366 CTGAATTTGTAATGGTGACATGG - Intronic
994677725 5:102846249-102846271 ATGAGCTTGTAAAACACACATGG + Intronic
995344284 5:111093538-111093560 CTGAGCTGGTAATGGAGACAGGG + Intronic
995399313 5:111722277-111722299 CTGAGGTTGTTAAAAGGACAAGG + Intronic
996135426 5:119836075-119836097 CTGTGCATGTAAAAGAGGCAGGG - Intergenic
996580356 5:125025516-125025538 CAGAGCTTGGAAAAGTGATCTGG + Intergenic
996950183 5:129117108-129117130 CTGAGCCTTTAAAAGGGACTGGG + Intergenic
999101493 5:149029261-149029283 CTGTGTTTGTAAAAGTGGCAGGG + Intronic
1000071873 5:157747899-157747921 ATGAGCTGAGAAAAGTGACAAGG - Intronic
1001760509 5:174204282-174204304 CTCAGCTTTTAAAACTGAAAGGG + Intronic
1002126043 5:177044919-177044941 CTGAGCATGTGAAAAAGACAAGG - Intronic
1005500514 6:26425282-26425304 CTGATATTGAAAAAGTGATATGG + Intergenic
1005809312 6:29504003-29504025 CTGAGCTTGAAGAGGTGGCATGG + Intergenic
1006081216 6:31568041-31568063 CTGATGTTGTAAGAGTGGCAGGG - Intergenic
1007660161 6:43479315-43479337 CTGACCTAGTAACAGTGACTTGG - Intronic
1012696545 6:102391417-102391439 CTGAGCTAATGAAAGTGGCAGGG - Intergenic
1014983646 6:127976184-127976206 ATGAACTTGGAACAGTGACATGG + Intronic
1015435927 6:133188050-133188072 CTGAGGATGTAAAGATGACAAGG - Intergenic
1015469263 6:133585300-133585322 CTCAGCTTGTAAAATTGAGTAGG - Intergenic
1016428676 6:143960274-143960296 CTGAGCTTTAAAAAATGAAAGGG + Intronic
1018292457 6:162306581-162306603 CTGAGCTTCTCAAAGAGCCAGGG - Intronic
1019385822 7:755569-755591 CTGGGCTAGTAACAGTGACCTGG - Intronic
1020330514 7:7012583-7012605 CTGAGCAGGTAAAAGAGCCAAGG - Intergenic
1020899687 7:13989753-13989775 CTGATCTTGTGAAAGAGACGCGG - Exonic
1023792465 7:43763821-43763843 CTGAGTTTGTAAAAGAGAAACGG - Intronic
1024164568 7:46717765-46717787 CTGAGATTGCAAAAGGGAAAAGG - Intronic
1024214476 7:47235851-47235873 CTGATCTGTTAAAACTGACATGG + Intergenic
1026541027 7:71280159-71280181 CTGAGGTTGTGGAAGAGACAGGG + Intronic
1026602235 7:71786330-71786352 CTGAGCTTGGAAAAGTACAAAGG + Exonic
1030492654 7:110257321-110257343 CTGGGCTAGTTAAAGGGACATGG - Intergenic
1031576714 7:123423097-123423119 CTGATCTGGTGAAAGTAACAGGG - Intergenic
1033575304 7:142676634-142676656 CTGAGCTTGTCTCTGTGACATGG + Intergenic
1033734774 7:144210918-144210940 TTGAGATTATACAAGTGACAGGG - Intergenic
1033748281 7:144340051-144340073 TTGAGATTATACAAGTGACAGGG + Intergenic
1043553163 8:81398372-81398394 CTGAGTCAGAAAAAGTGACAGGG + Intergenic
1044348670 8:91137186-91137208 TTGACCTTGAAAATGTGACATGG + Intronic
1046258125 8:111727896-111727918 CTGAGCTTTTACAATTGAAAAGG - Intergenic
1046530531 8:115439277-115439299 TAGAGCTTGTGAAACTGACATGG + Intronic
1046581082 8:116093331-116093353 GTGAGCTTGTAAATGTTACGGGG - Intergenic
1047517328 8:125566531-125566553 CTGAGCTAGCAAAAGAGAAAGGG - Intergenic
1048216949 8:132504942-132504964 ATGAGGTTGTTAGAGTGACAGGG - Intergenic
1050074902 9:1853221-1853243 CTGATCTTGGAAAAGCCACAGGG + Intergenic
1050282174 9:4061927-4061949 CTGAGCTTCTTTAAGTCACATGG + Intronic
1050737583 9:8781594-8781616 CTAAGCTTTTAAAGGTCACATGG + Intronic
1050749311 9:8918458-8918480 CTGATGTTCTAAAAGTGAAAGGG - Intronic
1051599261 9:18855950-18855972 CTGTGCATGTAAGAGTGCCATGG - Intronic
1052986551 9:34492078-34492100 CTGAGGCATTAAAAGTGACATGG - Intronic
1053348953 9:37399208-37399230 CTGCGCTTGTAAAAGGCCCACGG + Intergenic
1059972607 9:119683072-119683094 CTGAGCTTATAAAATAGAAAGGG - Intergenic
1060285085 9:122243789-122243811 CTGATTTTGTATAAGTCACAGGG + Intronic
1187310523 X:18137030-18137052 CTGAGCTTCTCACAGTGAAAGGG - Intergenic
1187972397 X:24671987-24672009 CTGTGCTTTTAATAGAGACAAGG - Intronic
1188662072 X:32773095-32773117 CTGAGCTTGTTAAATTTACAGGG - Intronic
1189527846 X:41844524-41844546 CTGACCTTATAAAAATGAAAAGG - Intronic
1190116615 X:47629669-47629691 CTGAGCCTGTAACAGGGCCAGGG + Exonic
1190153750 X:47970240-47970262 CTGAGATTGGAAATGAGACAAGG - Intronic
1191142403 X:57130493-57130515 CTGAGCTTTTAATAGTGTGAGGG - Intergenic
1192144498 X:68672542-68672564 CTGAGCTTGTGAAAGCTCCATGG + Intronic
1193882720 X:86944012-86944034 CTGAGCATTTAAAAATGATAGGG + Intergenic
1194362250 X:92966470-92966492 GTGAACTTTTCAAAGTGACATGG + Intergenic
1195555134 X:106212937-106212959 TTGAGGTTGTAAAACTAACAAGG + Intergenic
1196066608 X:111471196-111471218 CTGAGCCTGGAAAAGCCACAAGG - Intergenic
1198634899 X:138686322-138686344 CTGTGCTTATAAAAGTGAAATGG + Intronic
1199680525 X:150221399-150221421 CTGAGCCTGGAAGAGTGAAAAGG - Intergenic
1200670503 Y:6082693-6082715 GTGAACTTTTCAAAGTGACATGG + Intergenic
1201336892 Y:12891310-12891332 CTCAGCTTCCCAAAGTGACAGGG + Intergenic