ID: 1081523619

View in Genome Browser
Species Human (GRCh38)
Location 11:43907542-43907564
Sequence GGGAGAAAAACCTCTACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081523619_1081523625 15 Left 1081523619 11:43907542-43907564 CCAGTGGTAGAGGTTTTTCTCCC 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1081523625 11:43907580-43907602 AGGACTATTCCTAAGCCATCTGG 0: 1
1: 0
2: 0
3: 4
4: 82
1081523619_1081523626 22 Left 1081523619 11:43907542-43907564 CCAGTGGTAGAGGTTTTTCTCCC 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1081523626 11:43907587-43907609 TTCCTAAGCCATCTGGTATCTGG 0: 1
1: 0
2: 0
3: 5
4: 140
1081523619_1081523620 -5 Left 1081523619 11:43907542-43907564 CCAGTGGTAGAGGTTTTTCTCCC 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1081523620 11:43907560-43907582 CTCCCCTTGCCATACTCTTAAGG 0: 1
1: 0
2: 0
3: 6
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081523619 Original CRISPR GGGAGAAAAACCTCTACCAC TGG (reversed) Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
901201386 1:7469338-7469360 AGGAGAAAACCCTCTGCCAAGGG - Intronic
905006434 1:34713858-34713880 GGGAGTAAGGCCTCTTCCACGGG - Intronic
910703428 1:90101506-90101528 GGGACAAACACCTCCACCACAGG - Intergenic
912951213 1:114121919-114121941 TGGACAACAATCTCTACCACAGG - Intronic
914221165 1:145683122-145683144 GGGAGAAAAGTCTTTACCATTGG - Intronic
914473737 1:148005995-148006017 GGGAGAAAAGTCTTTACCATTGG - Intergenic
919201650 1:194362530-194362552 CAGACAAAACCCTCTACCACAGG - Intergenic
920697880 1:208195507-208195529 GGGAGATAAACCACAGCCACTGG - Intronic
924367165 1:243307201-243307223 TGGAGAAAAACCTCATCCAGAGG + Intronic
1062896042 10:1104179-1104201 GGGAGAAGAGCAGCTACCACGGG - Intronic
1064621335 10:17220629-17220651 GAGAAAAAAAATTCTACCACTGG + Intergenic
1071186775 10:83055460-83055482 GTGTTACAAACCTCTACCACAGG - Intergenic
1073512449 10:104051312-104051334 GGGAGCCCAACCTCTGCCACAGG + Intronic
1074556836 10:114499182-114499204 GACAGAAAAACATCTTCCACAGG + Intronic
1077835546 11:5923755-5923777 GGCAGGAAAGCCTCTCCCACAGG - Intronic
1079416063 11:20237808-20237830 GGCAGAACAACCTCTCCCAGTGG + Intergenic
1080761717 11:35256801-35256823 GTGAGAAAAATCACTTCCACTGG + Exonic
1081523619 11:43907542-43907564 GGGAGAAAAACCTCTACCACTGG - Intronic
1084404025 11:68960741-68960763 GGGAGAGAAACACCCACCACAGG - Intergenic
1085244942 11:75093451-75093473 GGGAGAACAACCTCTAGAATGGG - Intergenic
1087749414 11:101990436-101990458 AGGAAAAAAGCCTCTACCCCTGG + Intronic
1090767067 11:129885344-129885366 GGGAGATAAATGGCTACCACTGG + Intronic
1091565099 12:1642364-1642386 GGGAGAAAAACTACTAACAATGG - Intronic
1095042932 12:37464239-37464261 GGGAGAAAACCCTCAACTCCTGG - Intergenic
1095528632 12:43158144-43158166 GGGACAAAAACCTAGACCATAGG + Intergenic
1102629654 12:114266750-114266772 GGGAGAGAAACATTTACCAGAGG - Intergenic
1103959023 12:124595872-124595894 TGGAGCAAAACCTCACCCACTGG - Intergenic
1104644121 12:130485047-130485069 AGGAGAAAACCCTTTCCCACTGG + Intronic
1109249352 13:60000209-60000231 GGTAGAGAAATATCTACCACAGG + Intronic
1114378984 14:22180329-22180351 GGGAAAAAAATCTCTACCTTTGG + Intergenic
1118806474 14:69241520-69241542 GGGAGAAAAAGTTCTTCCAAAGG + Exonic
1120337484 14:83175297-83175319 GGAAGAAGTACCTCTATCACTGG + Intergenic
1123811700 15:23932873-23932895 GGGAGAGAAACCTCTACTTAGGG - Intergenic
1126292002 15:47091565-47091587 GGGAGAAAACCCTCAACTCCTGG + Intergenic
1127169040 15:56279540-56279562 GGGAAGAAAACCACAACCACTGG + Intronic
1127674187 15:61225237-61225259 GGGAGAAAAGCCTTTGCCAGAGG - Intronic
1127931415 15:63599882-63599904 GGGGGAATAATGTCTACCACTGG - Intronic
1128399161 15:67259597-67259619 GGGAGTAAAAACTGTACCAAAGG - Intronic
1130688286 15:86058232-86058254 AAGAGAAAAACATCTACCAAAGG + Intergenic
1137862250 16:51857937-51857959 GGAAGGAAAATCTCTTCCACAGG + Intergenic
1139336488 16:66235515-66235537 GGGAGACATGCCTCTTCCACGGG - Intergenic
1141380443 16:83571678-83571700 GGGAGAATAAACTTTACCCCTGG - Intronic
1143972070 17:10803222-10803244 GGGAGAAAAGTCTTTAGCACAGG - Intergenic
1144042015 17:11420468-11420490 GGAACAAAAAACTCTACCACTGG - Intronic
1144795997 17:17891626-17891648 GGGTCAGAAAGCTCTACCACAGG + Intronic
1146610426 17:34300006-34300028 GGGATAAAGACATCTGCCACTGG + Intergenic
1146786158 17:35723506-35723528 GGGAGAGAAACTTCTATCACTGG - Intronic
1148098740 17:45073905-45073927 GGAAGAAAAAGCTCTATCATAGG - Intronic
1149481874 17:57010043-57010065 GGAAGCAAAAATTCTACCACTGG - Intergenic
1150198322 17:63325223-63325245 GGGAGCAAAACCACTGCCAGTGG + Intronic
1152347255 17:79760698-79760720 GGAAGAAAAACCACCACCTCTGG - Intergenic
1156582790 18:38396759-38396781 GAGACAAAAACCTCTGTCACAGG - Intergenic
1157037397 18:43991377-43991399 GGGAGAAAAACATCACACACTGG - Intergenic
1159386272 18:67729183-67729205 GGAAGAAAAATATCTACCCCTGG - Intergenic
1167771939 19:51526134-51526156 AGGAAAAAGCCCTCTACCACTGG + Intronic
925208401 2:2026612-2026634 TGCAGAACAACCTCCACCACGGG - Intronic
927678638 2:25125272-25125294 GGCAGAAAAACTTCTACCCAGGG - Intronic
930686112 2:54310119-54310141 GAGAGAAAAAGCTATACTACAGG - Intergenic
931459483 2:62437742-62437764 GGGGGAAACACCTCTACGATGGG + Intergenic
931815426 2:65896208-65896230 GGGAGGAGAACATCAACCACTGG + Intergenic
937299691 2:120831667-120831689 GGGACAATAACCTGCACCACCGG - Intronic
937779365 2:125819707-125819729 AGGAGAACATTCTCTACCACAGG - Intergenic
939238595 2:139530044-139530066 GGGATATATACTTCTACCACAGG - Intergenic
939446786 2:142320791-142320813 GGGGGAAATATCTCAACCACGGG + Intergenic
941412915 2:165182507-165182529 GGGAGAAAAACCACAGCCAGAGG + Intronic
942273211 2:174297843-174297865 GGGAGAAAAACCTCCTTAACAGG - Intergenic
944515177 2:200505875-200505897 GAGAGAAAAACCTCTACATGAGG + Intronic
945588325 2:211695673-211695695 GTGAGAAAAACATCAACCATTGG - Intronic
946163397 2:217849243-217849265 GACAGAAAGACCTCTACCCCAGG + Intronic
947571442 2:231238797-231238819 GGGTGACAGACCTCTGCCACAGG + Intronic
948096118 2:235335205-235335227 ATGAGAAAAACCTCAGCCACTGG - Intergenic
1169470292 20:5879185-5879207 GACAGAGAAACCTTTACCACAGG + Intergenic
1170121126 20:12913446-12913468 GCCAGAGAAACTTCTACCACAGG + Intergenic
1171537355 20:25906994-25907016 GGGAGAAAACCCTCAACTCCTGG - Intergenic
1171803756 20:29654292-29654314 GGGAGAAAACCCTCAACTCCTGG + Intergenic
1171840308 20:30202333-30202355 GGGAGAAAACCCTCAACTCCTGG - Intergenic
1173972338 20:47162435-47162457 GAGACAAAAATCTCTATCACTGG - Intronic
1178950260 21:36980213-36980235 GGAAGAAACAACTCAACCACAGG + Intronic
1180243283 21:46526833-46526855 GGGAGAAAAAGCTGAACAACTGG - Intronic
1180994079 22:19955939-19955961 GGGAGAAAGACAGCTACCAGGGG - Intronic
1185010070 22:48307845-48307867 GGGAGAAAACCCTCTTCCCAGGG + Intergenic
949454846 3:4227563-4227585 GGGAGATTAACCTCAAACACAGG + Intronic
949625431 3:5861252-5861274 GGGAAAAAAACCTCTAATTCAGG - Intergenic
954318113 3:49812318-49812340 GGGAGAAAAACCCATCCCAAGGG + Intronic
954611639 3:51947469-51947491 GGGAGAAAAGCCCCTGCCACGGG + Intronic
955864631 3:63370240-63370262 TGGAAAAAAACATCTTCCACAGG - Intronic
956275848 3:67500259-67500281 TGGAGAAAACCCTCTACCTGGGG - Intronic
963018560 3:140849432-140849454 GGGAGAAACCCATCTACCAGGGG + Intergenic
963135716 3:141901970-141901992 GGGATAAAATCCTCTACACCAGG - Intronic
963836451 3:150062515-150062537 GGGAGAAAAAGCTGTTCCAAAGG + Intergenic
969182291 4:5451603-5451625 GGTGGAGAAACCTGTACCACGGG - Intronic
971428787 4:26542072-26542094 GGGAGACAATGCTCTTCCACAGG + Intergenic
971448942 4:26781406-26781428 GGAAATAAAACCTCTTCCACTGG + Intergenic
976231152 4:82844488-82844510 GGGAGAAAATCCTCCACCTCCGG - Exonic
976335343 4:83878979-83879001 GGGTGTAAACCCTCTACCATGGG - Intergenic
979663821 4:123288926-123288948 GGGAGAAAAACAGATACCAAAGG - Intronic
980909313 4:138979426-138979448 GGGAGGAAAACGTCCACCTCAGG - Intergenic
989948361 5:50267063-50267085 GGGGAAAATAGCTCTACCACTGG + Intergenic
991457948 5:66824377-66824399 GGGAGAAACAACTTTACCAGAGG + Intronic
992656995 5:78920616-78920638 GGGGGACACACCTCCACCACAGG + Intronic
995823045 5:116259728-116259750 AGGTGAAAAACTTCTACAACCGG - Intronic
998946413 5:147344612-147344634 GGGGGAAAAACAATTACCACTGG + Intronic
999531055 5:152464044-152464066 GGGGGAAAAATCTTTCCCACTGG - Intergenic
1001103035 5:168829793-168829815 GTGAGAAACACCTAAACCACAGG + Intronic
1006704721 6:36009575-36009597 GGGAAAAAAACCAATACCAAAGG + Intronic
1007768607 6:44176418-44176440 AGGAGAACAACCTGTACAACAGG + Intronic
1011497501 6:87950999-87951021 GGGAGAAAAGTGTCTAACACAGG - Intergenic
1014769974 6:125449595-125449617 GGGAAAAAAACCTATAAAACAGG - Intergenic
1015681111 6:135809507-135809529 GGGATAACAAACTGTACCACTGG + Intergenic
1015723101 6:136266495-136266517 GGGAAAAGCACCTCTACCACAGG + Intronic
1016794434 6:148102772-148102794 GGGAGAAAAAATTCTATCAGTGG + Intergenic
1016800553 6:148164734-148164756 TGGAGAGAAACCCCCACCACTGG + Intergenic
1020876520 7:13701836-13701858 GAGAGAAAAATCCCTACCTCGGG - Intergenic
1021825758 7:24549377-24549399 GGGAGAAAAACCTCCATAAATGG - Intergenic
1023324003 7:39032563-39032585 GTTAGAAAAAGCTCTTCCACAGG - Intronic
1025288831 7:57693828-57693850 GGGAGAAAACCCTCAACTCCTGG - Intergenic
1028236476 7:88368853-88368875 GGGAGAATCACCTCTGTCACTGG + Intergenic
1034397229 7:150836329-150836351 GGTAGAAAGGCCTCTGCCACGGG - Intronic
1037924689 8:22834956-22834978 GGGAGAAAAATCCCTATCATAGG - Intronic
1041235960 8:55802554-55802576 GGGAGAAGAGCCTGTACCTCTGG - Exonic
1041672753 8:60509164-60509186 GAGAGAAAAACTGCCACCACAGG - Intergenic
1044132917 8:88548802-88548824 GGGAGAAATACCGGTACCAATGG + Intergenic
1044217950 8:89634995-89635017 GGGTAAAAAACCTCTACATCTGG - Intergenic
1046740422 8:117821853-117821875 GAGGGATAAATCTCTACCACCGG - Intronic
1059035524 9:110750245-110750267 GGGAGAAAGAGCTCTGGCACGGG - Intronic
1185980840 X:4776037-4776059 GGGAGAAAATCTCCCACCACTGG - Intergenic
1194892489 X:99397888-99397910 GGAAGAAGAACCTCTCCCATTGG + Intergenic
1197845915 X:130802626-130802648 GGGAGACCAAACTCTGCCACTGG - Intronic
1201931181 Y:19350671-19350693 AGAAGAAAAAACTCTACCTCAGG + Intergenic
1202112033 Y:21431449-21431471 TTGAGAAAGATCTCTACCACAGG + Intergenic