ID: 1081528278

View in Genome Browser
Species Human (GRCh38)
Location 11:43942077-43942099
Sequence CGCGCGCGCGCCTGCGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081528278 Original CRISPR CGCGCGCGCGCCTGCGGAGG GGG Intronic
900091778 1:923953-923975 CGGGCGCGCGCCAGTGGACGCGG + Intergenic
900162826 1:1232417-1232439 CGCGCGGGCGCGGGGGGAGGCGG - Exonic
901361387 1:8703503-8703525 TGTGCGCGCGCCCGCGGCGGCGG - Intronic
902350027 1:15847646-15847668 CGCGCGCGCGCCCGCGGCGAGGG + Intergenic
902585737 1:17437962-17437984 CGCGCCCGGGCCCGCGGCGGGGG - Intronic
903614642 1:24643126-24643148 CGCACGAGCGCCAGCGGGGGCGG - Exonic
903879825 1:26500972-26500994 CGCGCGCGCACGTGCCGGGGCGG + Intergenic
904618195 1:31761029-31761051 CGCGCGGGCGGCGGGGGAGGGGG + Intronic
905066844 1:35192089-35192111 TGCGCGCGCCGCTGCGGGGGCGG - Intronic
906027123 1:42682894-42682916 TGCGCGCGCGCCTGCCGGGCGGG - Intronic
907523442 1:55039912-55039934 CGCGGGCGCCCGTGCGCAGGAGG + Exonic
910251424 1:85201657-85201679 CGCGCTCGCGGAGGCGGAGGCGG + Intergenic
911527543 1:99004755-99004777 CGGGGGCGCGGCGGCGGAGGCGG + Exonic
912174702 1:107141285-107141307 CCCGCTCCCGCCTGGGGAGGAGG + Intronic
914428492 1:147599864-147599886 ATCGCGCGCGTCTGGGGAGGGGG + Intronic
917975094 1:180233268-180233290 CGCACGGGAGCCTGCGGGGGCGG - Intronic
921603982 1:217135521-217135543 CGCGCGCGCGGCGGCGGCGGCGG + Intronic
922958557 1:229625814-229625836 CGCGCGCGCGCGGGCGGGCGGGG - Intronic
1063369206 10:5509906-5509928 CGGGCAGGGGCCTGCGGAGGTGG + Intergenic
1065099091 10:22316270-22316292 CCCGCGCGCGGGCGCGGAGGCGG + Exonic
1066370460 10:34815000-34815022 CGCGGGCCCGCCCGCGGCGGCGG - Exonic
1070942119 10:80357061-80357083 GGGGCGCGCGCCAGGGGAGGGGG + Intronic
1074756510 10:116627816-116627838 CGCGCACACGGCCGCGGAGGCGG + Exonic
1076374191 10:129972707-129972729 CGCGGGCGGGGCTGCGGCGGAGG - Intergenic
1078180298 11:9004740-9004762 CGCGTGCGCTCCCGCGGAGGCGG - Intergenic
1080779768 11:35419417-35419439 TGTGTGCGCGCCTGGGGAGGCGG + Intronic
1081528278 11:43942077-43942099 CGCGCGCGCGCCTGCGGAGGGGG + Intronic
1082775665 11:57242590-57242612 CGCGCGCGTGCCTAGGGTGGGGG - Intergenic
1084014626 11:66371364-66371386 GGCGGGAGGGCCTGCGGAGGCGG - Intronic
1084146154 11:67266432-67266454 CGCGGGCGCGCGGGCGGCGGCGG + Exonic
1084146156 11:67266438-67266460 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1085423250 11:76381194-76381216 CGCGTGCCCGCCTGCTGAGAAGG - Intergenic
1087795684 11:102452889-102452911 CAAGCGCGCGCCTGCGAGGGAGG - Exonic
1090699331 11:129279691-129279713 CGCGCGCGCGGCCGAGGGGGCGG + Intergenic
1091718418 12:2795544-2795566 CGCGCGCGGGGCGGCGGAGAGGG + Intronic
1092204696 12:6607587-6607609 CGCGCGCGCGCCCGCTGCGAAGG - Intergenic
1092843341 12:12562953-12562975 CGCGCGGGCGCGGGAGGAGGAGG - Intergenic
1093235652 12:16605982-16606004 CGCGCGTGCGTGTGCGGATGTGG - Intronic
1093547679 12:20368242-20368264 CCCGCCCCCTCCTGCGGAGGAGG - Intergenic
1094125001 12:27014312-27014334 CGCGCCGGCGGCTGCGGAGCTGG - Exonic
1095465570 12:42484357-42484379 CGCGCGTGCACCTGCGGGAGGGG - Intronic
1096101295 12:48971829-48971851 CGCGCGCGCGCGCTGGGAGGAGG - Intergenic
1096284146 12:50283549-50283571 CGTGCGCGCCCCCGCGGCGGTGG - Intergenic
1096837387 12:54359403-54359425 CGGGCGGGCGACTGGGGAGGGGG + Intergenic
1096994615 12:55830809-55830831 CGCGCGCGTGCGCGCGGTGGGGG - Intronic
1097989970 12:65824379-65824401 CGCGCTTGCGCTTGGGGAGGGGG - Exonic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1102025801 12:109713886-109713908 CGCGCGCCGGCCGGGGGAGGCGG + Intergenic
1103364011 12:120369330-120369352 AGCCCGGGCGCCCGCGGAGGCGG + Intergenic
1108063326 13:46553585-46553607 GGAGCGCGCGCTTGAGGAGGCGG + Exonic
1108435347 13:50396735-50396757 CGGGCCAGCGGCTGCGGAGGGGG + Intronic
1111396540 13:87673976-87673998 CGCGCGCGCGCATGCTGCGTTGG - Intronic
1111672490 13:91348146-91348168 CGCCCGCGGGCCGGCGGAGGGGG + Intergenic
1112505078 13:99970573-99970595 TGCGCGGGCGCCGGCGGCGGCGG + Exonic
1113655606 13:112066658-112066680 CGCGCGCGCGGCGGCGGCGGCGG - Intergenic
1113820370 13:113209024-113209046 GGCGCGCGCGCCCGAGGAGGGGG + Intronic
1117141086 14:52791625-52791647 CGCGCGCAGGCGAGCGGAGGCGG + Intronic
1119325276 14:73756299-73756321 CGCGCGCGTGCGCGCTGAGGTGG + Intronic
1120881056 14:89416115-89416137 CGCGCGCGCGCGTGCTGGGTGGG - Intronic
1122162295 14:99793296-99793318 GGCTCGCGCGGCTGCGGCGGCGG + Intronic
1122231198 14:100306973-100306995 CGCCTGCGCGCCCGCGGCGGCGG + Intergenic
1122275119 14:100587197-100587219 CGCGGGCGCGGGCGCGGAGGCGG - Intronic
1122657844 14:103273918-103273940 CGCGTGCGCGCCTGGGGACGCGG - Intergenic
1124629383 15:31328025-31328047 CCCGAGCGCGCCCGGGGAGGGGG - Intronic
1125270534 15:37934100-37934122 CGCGCGCGCGTGTGTGTAGGGGG - Intronic
1125521961 15:40353150-40353172 CGCGCGCGCGCATCCGTGGGAGG + Intronic
1126852346 15:52805117-52805139 CCCGCTCGCGCCTGCAGGGGAGG + Intergenic
1127784641 15:62345008-62345030 CACGCGCGCGCCTGAGTAGCAGG - Intergenic
1128791137 15:70434706-70434728 CGCGCGCGCGCGGGTGGAGCGGG - Intergenic
1129273946 15:74433445-74433467 CGCCCGGGCGCCAGGGGAGGGGG - Intronic
1130002612 15:80060054-80060076 CGCGCGGGCGCCCGCGGCCGGGG + Intronic
1130362964 15:83207692-83207714 AGCGCGCGCGGCGGCGGCGGCGG - Exonic
1131113044 15:89777052-89777074 CACCCGAGCGCCTGGGGAGGGGG + Exonic
1132105356 15:99059120-99059142 CGCGTGCGCGCCGGCCGCGGCGG + Intergenic
1132885119 16:2179096-2179118 CGCGGGCGCGCCGGGGGACGGGG + Exonic
1135821721 16:25691885-25691907 CTCGCGCGCGCCTGCGAAGGGGG - Intergenic
1137655254 16:50153543-50153565 CGGGCGTGCGCCTGAGGCGGCGG + Intronic
1138228872 16:55323762-55323784 CGCGCGCGCGCCTCCCGCAGTGG - Exonic
1138327991 16:56191419-56191441 CGCGCGCGCGCCTGGGCCCGGGG - Intronic
1138956861 16:61981683-61981705 CGCGCGCGCGCGTGCGCTTGGGG + Intronic
1142271839 16:89093924-89093946 CGCGCGCGCGGCGGAGGACGAGG + Exonic
1146492391 17:33292292-33292314 CGGGCGGGCGCCCGCGGAGGCGG - Exonic
1147161770 17:38572772-38572794 GGCGGCCGCGGCTGCGGAGGCGG - Intronic
1147264173 17:39225202-39225224 CGCGCGCGGGCGTGCGGTGCCGG + Intronic
1147731942 17:42609530-42609552 CGCGTGCGCGGCTCCGGATGCGG - Intronic
1147990008 17:44326805-44326827 CGCGCGGGCGGTGGCGGAGGGGG + Intergenic
1148419052 17:47531031-47531053 CGCGCGCACGCCTGGGCAGAGGG - Intronic
1148558594 17:48593173-48593195 CTCGGGCGCGGCTGTGGAGGTGG + Exonic
1151854336 17:76710631-76710653 CGCGGCGGCGCCAGCGGAGGCGG - Exonic
1153872546 18:9334511-9334533 CGGGCGGGAGCCTGCGGTGGAGG + Intergenic
1153935103 18:9914216-9914238 CGGGGGCGCGCCCGCGGCGGCGG - Exonic
1154991379 18:21600980-21601002 AGCGCGCGCGCCTCCGCGGGTGG + Intergenic
1157473775 18:48008576-48008598 CGCGGGCGGGCCGGCGGCGGAGG - Intergenic
1158427473 18:57352710-57352732 AGCGCGCGCGCGTGTGGCGGAGG - Exonic
1160157015 18:76441941-76441963 CACGCGCGCCCCGGCCGAGGAGG - Exonic
1160714977 19:572465-572487 CGTGTGCGCGCGTGCGCAGGCGG + Intronic
1160873143 19:1286005-1286027 CGCGCGCGCGGAGGCGGGGGCGG + Intergenic
1160895884 19:1401595-1401617 CGCGCGCGCGGCTCCGGGAGCGG + Intergenic
1160909002 19:1466249-1466271 CACGCGGGCGTCGGCGGAGGTGG - Exonic
1161175945 19:2842053-2842075 CGCGGGAGCGCGAGCGGAGGCGG - Intronic
1161264780 19:3359285-3359307 CGCGCGCGCCGCGGCGAAGGTGG + Intergenic
1161265157 19:3360342-3360364 CGCGCGCGCGGCAGCGGGGCCGG - Intronic
1161388090 19:4007602-4007624 GCCGCGCGCGCCTGCGCAGGAGG + Intergenic
1161401599 19:4067973-4067995 CGACCGCGCGCCTGGGGGGGGGG + Intergenic
1161643071 19:5436363-5436385 CGCGCGCGCGCGTGCGGGGAGGG + Intergenic
1161802582 19:6424397-6424419 CGCGCGCGCGCAGGCGGGGGAGG - Intronic
1161802586 19:6424403-6424425 CGCTCGCGCGCGCGCGCAGGCGG - Intronic
1162100221 19:8334662-8334684 AGCCCGCGAGGCTGCGGAGGAGG - Exonic
1162954503 19:14090784-14090806 CGCGCGTGCGGCGGCGGCGGCGG - Intronic
1163782574 19:19258150-19258172 CGCGCGCGCAGCTCCGGAGAAGG + Exonic
1165349522 19:35268522-35268544 CGCGCGCGCGGCGGCGGCGGCGG - Intergenic
1166106715 19:40601303-40601325 CGCCCGCCCGCCCGCGGGGGAGG - Intronic
1166961041 19:46495920-46495942 CGCGCGTGCGCCTGCGCAGAGGG + Exonic
1167633491 19:50639823-50639845 GGCGCGCGGGGCTGCGGCGGCGG - Intronic
1168153543 19:54461328-54461350 CCCGTGCCCGCCTGCGGCGGGGG + Exonic
1168272839 19:55259155-55259177 CGCAAGCGCGTCTGCGGCGGCGG - Intergenic
1168286928 19:55339924-55339946 GGCGCGGGCGCCTGAGGAGGAGG + Exonic
1168339357 19:55614589-55614611 GGCGCTCCCGTCTGCGGAGGGGG - Exonic
924985371 2:264792-264814 CTCCAGTGCGCCTGCGGAGGCGG - Intronic
926020185 2:9487837-9487859 CGCGCGCGCGCGCGCTGTGGGGG + Intronic
927975962 2:27338430-27338452 CGCGTGCGCGCCTGTGTAGAGGG - Intronic
928420950 2:31137708-31137730 CGCGCGCTCGCCTGCGGAGCGGG - Intronic
931739374 2:65228087-65228109 CGCTCCCACGCCCGCGGAGGTGG - Intronic
935815527 2:106843197-106843219 CGCGCGCGCGGCTCCGCAGCTGG + Exonic
937183074 2:120013278-120013300 CTCGCCCGCGCCTGCGGTAGCGG + Intronic
937203893 2:120223580-120223602 CCCGCGCGCGCGAGCAGAGGCGG + Intergenic
939153802 2:138501750-138501772 CGTGCGCGCGGCGGCGGCGGCGG - Intergenic
941104844 2:161341011-161341033 CGCGGCGGCGCCAGCGGAGGCGG - Intronic
943669861 2:190649078-190649100 CGCGCGGGCGGCGGCGGCGGCGG - Intronic
945251703 2:207769963-207769985 CGCGCCCGGGCCTGAGGGGGCGG - Intergenic
947353636 2:229271308-229271330 CGAGCGCGCGGCGGCGGCGGGGG + Intergenic
1169382463 20:5119963-5119985 AGAGCGCGCGCTTGCGGACGCGG - Intronic
1171452867 20:25248162-25248184 CGCCATCGCGCCGGCGGAGGCGG - Exonic
1172474529 20:35226885-35226907 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1172644479 20:36461390-36461412 CGCGCGCGCGGCTGACGCGGGGG + Intronic
1174374004 20:50113191-50113213 TGCGCGCGCGCCTGCGCATCAGG - Intronic
1174467868 20:50731435-50731457 CGCGCGCGGGCTCGCGGGGGAGG + Intergenic
1175074021 20:56358877-56358899 CGCGCGCGCGGCGGCGAAGCCGG + Intergenic
1176005653 20:62861166-62861188 CGCGGGCGCGGCTGCGGCTGCGG - Exonic
1176068927 20:63216039-63216061 CGCGCGGGCCCCTGGCGAGGCGG + Exonic
1176073816 20:63239569-63239591 TGCGCACGCGGCTGCGGACGGGG - Exonic
1176194568 20:63831292-63831314 CGCGCGCGCGCGGGCGGCGGGGG - Intergenic
1176549582 21:8215285-8215307 GGCGCGCTCGCCGGCCGAGGTGG + Intergenic
1176550495 21:8218948-8218970 CGCGCGCGCGCGTGCGTGCGGGG + Intergenic
1176557473 21:8259514-8259536 GGCGCGCTCGCCGGCCGAGGTGG + Intergenic
1176568507 21:8398319-8398341 GGCGCGCTCGCCGGCCGAGGTGG + Intergenic
1176576418 21:8442548-8442570 GGCGCGCTCGCCGGCCGAGGTGG + Intergenic
1176577337 21:8446218-8446240 CGCGCGCGCGCGTGCGTGCGGGG + Intergenic
1178610210 21:34073416-34073438 CGGGTGCGGGGCTGCGGAGGGGG + Intronic
1180014671 21:45074509-45074531 CGGGCGCGCGCACGCCGAGGGGG - Intronic
1180093067 21:45542459-45542481 CGGGCGCGCGGCTGCGGGGTGGG + Exonic
1181068746 22:20319842-20319864 CGGGCGGAGGCCTGCGGAGGCGG - Intronic
1183524975 22:38317408-38317430 AGCGCGCGAGCCGGCGGCGGGGG - Exonic
1184465934 22:44668874-44668896 CACGCGCGACCCTGCGGAAGGGG + Intronic
1203254468 22_KI270733v1_random:131606-131628 GGCGCGCTCGCCGGCCGAGGTGG + Intergenic
1203255392 22_KI270733v1_random:135289-135311 CGCGCGCGCGCGTGCGTGCGGGG + Intergenic
1203262524 22_KI270733v1_random:176685-176707 GGCGCGCTCGCCGGCCGAGGTGG + Intergenic
949987810 3:9553639-9553661 CGCGCGCGAGGCTGCGGCCGCGG + Intronic
950729786 3:14947607-14947629 CGCGCGGGCGGCGGCGGCGGCGG + Intronic
951485218 3:23202989-23203011 CGGCCGCGCGCCGGAGGAGGAGG + Intergenic
953099277 3:39809528-39809550 AGCGGGGGAGCCTGCGGAGGCGG - Intronic
953908876 3:46882164-46882186 CGCGTCGGCGGCTGCGGAGGGGG + Intronic
953925397 3:46980018-46980040 CGCGCGCGCGCCCGCGCGCGCGG - Intronic
954779070 3:53046017-53046039 CACCCGCGCTCCGGCGGAGGCGG + Exonic
955769246 3:62372549-62372571 CGGGCGGGCGGCGGCGGAGGCGG - Exonic
961665025 3:128489280-128489302 CGGGGGCGCGCCCGCGGAGCTGG - Intronic
961692662 3:128681150-128681172 CACACGCGGGGCTGCGGAGGCGG + Intergenic
962222220 3:133573654-133573676 CGCGCGCAGGCCTGGAGAGGAGG - Intergenic
962259953 3:133895856-133895878 AGCGCAGGCGCCGGCGGAGGAGG - Intergenic
962301960 3:134250887-134250909 CGTGCGCGCTCCCGGGGAGGCGG - Intergenic
963599964 3:147370472-147370494 CGCGCGCGCGTGTGCGGATGTGG + Intergenic
965590557 3:170357367-170357389 CGGGCGCGCGCCTGGGGGGAGGG + Intergenic
966593002 3:181702013-181702035 CGCGCGCGCGCATGGGGGGGTGG - Intergenic
968850489 4:3074617-3074639 CGGGGCCGCGCCGGCGGAGGCGG - Intergenic
969240219 4:5892554-5892576 CGCGCGCGGGCCAGACGAGGGGG - Intronic
971279975 4:25234505-25234527 CCCGCGCGCGCTGGCCGAGGTGG + Intronic
977908462 4:102502366-102502388 CGCGCGCGCGCGCACGGAGGGGG - Intronic
980130036 4:128809866-128809888 CGCGCGCGTACCTGCTGCGGAGG - Exonic
981061274 4:140427652-140427674 CGCGCGTGCGCGTGCGGTGGCGG + Exonic
984167448 4:176319911-176319933 CGCGCGCGCGCTCGCGTCGGAGG + Intergenic
984972560 4:185203974-185203996 CGCGCCCGCGCTTCCGGAGGCGG + Exonic
987901087 5:24013051-24013073 CGCGCGCGCGCAGGCTGTGGTGG + Intronic
991743778 5:69710577-69710599 CGCGCGGGAGCCTGCGGTTGGGG + Intergenic
991753930 5:69844658-69844680 CGCGCGGGAGCCTGCGGTTGGGG - Intergenic
991795350 5:70290309-70290331 CGCGCGGGAGCCTGCGGTTGGGG + Intergenic
991823150 5:70585852-70585874 CGCGCGGGAGCCTGCGGTTGGGG + Intergenic
991833247 5:70719778-70719800 CGCGCGGGAGCCTGCGGTTGGGG - Intergenic
991887717 5:71289828-71289850 CGCGCGGGAGCCTGCGGTTGGGG + Intergenic
992067456 5:73120709-73120731 GGCCCGCGCGCCTGCGCCGGCGG + Intronic
992067460 5:73120715-73120737 CGCGCCTGCGCCGGCGGCGGCGG + Intronic
993726948 5:91380223-91380245 CGCGCGGGCGGCAGCGGCGGCGG - Intronic
994367110 5:98928815-98928837 CGCGCGCGCGACGGCGGCGGCGG - Exonic
996091454 5:119355846-119355868 CGAGCGCGCGGCTCCGGGGGCGG + Intronic
998131266 5:139652142-139652164 CGCGCGCGCGCGCGCGCCGGCGG - Intronic
998166670 5:139848281-139848303 CGCGCGCGCGGCCGCGGCGGCGG + Exonic
1001065104 5:168529661-168529683 CGGGCGCGCGGCTTCGGCGGGGG + Exonic
1002176378 5:177403607-177403629 CGGGTGCGGGCCTGCGGGGGGGG + Exonic
1003325240 6:5085713-5085735 AGCGCGCGCGGCAGCGGCGGCGG - Exonic
1004203925 6:13574424-13574446 CGCGGGCTCGCGAGCGGAGGTGG + Intergenic
1006271990 6:32972085-32972107 CGAGCGCGCGCGCGCGGAGGGGG + Exonic
1006367060 6:33621935-33621957 CCCGCGCACGCCTTTGGAGGGGG + Intronic
1007673499 6:43576055-43576077 TGCGCACGCGCCCGCGGAAGTGG + Exonic
1007739653 6:44002831-44002853 CGCGCGCGCCCCGTCGGCGGCGG - Exonic
1007751265 6:44073380-44073402 CGCGCGTGCGCGTGCGGCGCCGG - Intergenic
1011517132 6:88166592-88166614 CGGGAGCGCGGCGGCGGAGGAGG - Intergenic
1014632537 6:123803919-123803941 CCCGAGCGCGCCTCCGCAGGCGG + Intergenic
1016823698 6:148368742-148368764 CGTGCGCGCGCATGTGGGGGAGG - Intronic
1024574144 7:50750426-50750448 CGCGTGCGCACCTGCTTAGGTGG - Intronic
1026665307 7:72336314-72336336 CGCCCGGGCGCCTGCGGGCGGGG + Intronic
1026822302 7:73557690-73557712 CGCGCACGCGCGCACGGAGGGGG - Exonic
1032298766 7:130668321-130668343 TGCGCGCGGGCCTCCGGCGGGGG - Intronic
1034147329 7:148884471-148884493 CGTGCGCGCGCGGGCGGCGGCGG + Intergenic
1034469881 7:151249394-151249416 TGCGCGCGCGCCTGCGTGTGTGG + Intronic
1035265020 7:157685551-157685573 CGCGCGGGGGCCGGAGGAGGAGG + Intronic
1037826801 8:22164861-22164883 CGGCCGCGCGCCCGCGGGGGAGG + Exonic
1037900479 8:22685430-22685452 CGCGCGCGCGCGCGCGGGGAGGG + Intergenic
1037901035 8:22689983-22690005 CGCACGCGCGCCTGCGTGCGGGG - Exonic
1038035365 8:23682481-23682503 CGCGCGCGTGGCTGCGGAGGCGG + Intronic
1038767910 8:30446844-30446866 CGCGCGCGCGCGCGCGGTGGAGG + Intronic
1039595453 8:38787130-38787152 CGCGCGCGCGGGGGCGGCGGCGG - Intronic
1039595455 8:38787136-38787158 CTCGCGCGCGCGCGCGGGGGCGG - Intronic
1042281852 8:67064297-67064319 CGCGCGGCCGCCTGCAGTGGGGG + Intronic
1042903027 8:73746960-73746982 CGCGGGAGCGGCTGCGCAGGCGG - Intronic
1047423562 8:124727074-124727096 CGCGCGCGCGCGTGGGGGCGGGG - Intronic
1048484259 8:134832347-134832369 TGCGCGCGCGCGTGGGGAAGGGG + Intergenic
1051079604 9:13279326-13279348 TGCGCGCGCGCCGGCGGGGAAGG - Intronic
1058467518 9:105244495-105244517 CGCGCGCGGCGCTGAGGAGGCGG + Intergenic
1059405845 9:114098104-114098126 CGCTCGCTCACCTGGGGAGGGGG + Exonic
1060283374 9:122228491-122228513 AGCGCGCGCGCGAGCGGGGGGGG - Intronic
1060514578 9:124257930-124257952 GGCGCGCGGGCCCGCGCAGGCGG + Intronic
1060952357 9:127612323-127612345 AGCGCGCCCACCTGAGGAGGCGG + Exonic
1061038735 9:128127728-128127750 CGCGCGCCCGCCCGCGGCGCCGG - Exonic
1061854364 9:133433471-133433493 TGCTCCCGCTCCTGCGGAGGAGG + Exonic
1203470869 Un_GL000220v1:114750-114772 GGCGCGCTCGCCGGCCGAGGTGG + Intergenic
1203478690 Un_GL000220v1:158722-158744 GGCGCGCTCGCCGGCCGAGGTGG + Intergenic
1186768057 X:12791455-12791477 GGGGCGCGCGGCGGCGGAGGAGG - Exonic
1187648323 X:21374140-21374162 CGCGTGCGCGGCGGCGGAGGCGG - Intergenic
1188003494 X:25002568-25002590 CGCGCGCGCCCTGGAGGAGGGGG - Intergenic
1189310603 X:40014817-40014839 CGCGCGCGCGCTCGTGGAGCGGG - Intergenic
1192762234 X:74105453-74105475 CGCTCGCCCGCCTGCCGCGGAGG + Intergenic
1195210928 X:102651868-102651890 CGCGCGGGCGCCTGCAAAGCTGG - Intronic
1195334082 X:103832267-103832289 CCCGCGCCCGCCAGGGGAGGGGG + Intergenic
1199086451 X:143634721-143634743 CGCGCGCACGCGAGCCGAGGGGG - Intronic
1199942446 X:152638799-152638821 CGCGCGCGCGCCTCAGGAAATGG - Intronic
1200128998 X:153830912-153830934 CGCGAGCGCGCCCACGGCGGCGG + Intergenic