ID: 1081528304

View in Genome Browser
Species Human (GRCh38)
Location 11:43942203-43942225
Sequence CGCGCCCCGCGCAGAACCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 58}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081528300_1081528304 24 Left 1081528300 11:43942156-43942178 CCGGGCGCTCAGGCTCGCCAGGC 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1081528304 11:43942203-43942225 CGCGCCCCGCGCAGAACCGGCGG 0: 1
1: 0
2: 0
3: 10
4: 58
1081528301_1081528304 7 Left 1081528301 11:43942173-43942195 CCAGGCTGCAAAGAGAGCTGAGA 0: 1
1: 1
2: 1
3: 50
4: 320
Right 1081528304 11:43942203-43942225 CGCGCCCCGCGCAGAACCGGCGG 0: 1
1: 0
2: 0
3: 10
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081528304 Original CRISPR CGCGCCCCGCGCAGAACCGG CGG Intronic
900162769 1:1232205-1232227 CGCGCACCGCCCCGAGCCGGCGG + Intergenic
901317346 1:8318052-8318074 CGGGCCCCGCGCGGATGCGGAGG + Intronic
904751136 1:32741966-32741988 CGCGCCCCCCGCCGCACCTGCGG + Exonic
1066221169 10:33336699-33336721 CGCGCCCAGCGCAGACCCCGGGG + Intergenic
1081528304 11:43942203-43942225 CGCGCCCCGCGCAGAACCGGCGG + Intronic
1084366581 11:68705176-68705198 CGCGCCGCCTGCAGAACGGGAGG + Intergenic
1090285578 11:125496248-125496270 CGCTCCCCGCGCAGCTCCGGCGG + Exonic
1102743662 12:115230861-115230883 CCCCCCACTCGCAGAACCGGAGG - Intergenic
1102933823 12:116881134-116881156 GGCGCCGCGCGCGGAGCCGGAGG - Exonic
1105071129 12:133235294-133235316 CCCGCCCCTCCCAGAGCCGGTGG - Exonic
1106602672 13:31200597-31200619 CGCGCCCCGCGCCGGGCGGGAGG + Intronic
1122975467 14:105168965-105168987 CGCGGCCCGCGCTGACCCCGAGG - Intergenic
1129221365 15:74133607-74133629 TCCTCCCCGCTCAGAACCGGTGG - Exonic
1132527498 16:425069-425091 CGGGTCCCGCGCGGACCCGGGGG - Intergenic
1132576871 16:668339-668361 CTCGCCCCGCGCAGCCCAGGTGG + Exonic
1132604507 16:788177-788199 CGCGCCCCGCACAGGCCCGGTGG + Intronic
1133049066 16:3106492-3106514 CGCGCCCCGGGCTGGACAGGTGG + Intergenic
1135135861 16:19884981-19885003 CTAGCCCCGCGCGGAACCGCCGG - Intronic
1138546583 16:57723115-57723137 CACGCACCGCGCAGAGCCTGGGG - Exonic
1138961499 16:62035214-62035236 CGCGCCCCTCGCAGGATCGGAGG - Intronic
1141957601 16:87383282-87383304 CGGGCCCCGCGCCCAACTGGTGG + Intronic
1151696574 17:75721200-75721222 CGCGCCCAGGGCCGGACCGGAGG + Intergenic
1152349913 17:79778565-79778587 CCCGCCCCCCTCAGAGCCGGAGG - Intronic
1152352593 17:79791832-79791854 CGGGCCCCGGGCAGAATCTGGGG - Intergenic
1152593129 17:81223248-81223270 CACGCCCCGCCCACAACCGCTGG - Intergenic
1152711195 17:81871163-81871185 CGCGCCCCGCCCTGAGCCCGCGG - Intronic
1159511358 18:69401159-69401181 CGAGACCCGCGCAGACCCGGCGG + Exonic
1160204734 18:76822981-76823003 CGCGGCCCGCGCTGAACTTGAGG + Intronic
1160797719 19:953477-953499 CCCCCCCCGTGCAGAGCCGGGGG + Intronic
1164634056 19:29779950-29779972 CCTGCCCCTCGCAGAACCGGTGG - Intergenic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
929788822 2:45009647-45009669 CCCGCTCCGCGCAGAACTGAGGG + Intergenic
934966914 2:98731244-98731266 CGCGCCCCGCGCCCCACCAGTGG + Intergenic
938407361 2:131039941-131039963 CGCGCCCTGCGCCGCAGCGGCGG - Intronic
1172661808 20:36573694-36573716 GACGCCCCGCGCCGAGCCGGAGG + Intronic
1175957560 20:62619041-62619063 TGCTCCCCGTGCAGAACCGGGGG - Intergenic
1180197906 21:46208441-46208463 CGCGCGCCTCGCAGCACCAGTGG - Intronic
1183407876 22:37639430-37639452 AGCGCCCCGCCCAGCCCCGGTGG - Intronic
1184712857 22:46263231-46263253 TGTGCCCCGCGAGGAACCGGCGG + Exonic
957939825 3:86990885-86990907 CGCGCCCCGCGCGGAGCCCGAGG - Exonic
960664486 3:120095617-120095639 CGCGCCCCGCCCAGCCGCGGGGG + Intergenic
964201457 3:154122413-154122435 CGCGGGGGGCGCAGAACCGGCGG - Exonic
967886014 3:194333892-194333914 CGCGCCCCGCGCAGACGTGGAGG - Intergenic
968433903 4:575496-575518 CGAGCCCGGCGCCGAGCCGGGGG + Intergenic
968474152 4:795292-795314 CGAGACCGGCGCAGAACGGGCGG + Intronic
970205762 4:13654307-13654329 CGCGGTCCCCGCACAACCGGCGG - Intergenic
985784630 5:1887329-1887351 CGCGCCGCGCGCAGACCGGACGG - Intergenic
989229854 5:39074007-39074029 CGGGCCCCGCACGGGACCGGCGG - Intronic
1000303043 5:159972594-159972616 CGCGCCCCAAGGGGAACCGGGGG + Intergenic
1000318884 5:160118671-160118693 CACGCGCCGCGCAGGACCAGAGG + Intronic
1001639427 5:173234571-173234593 CGCGCCCCGCGTCCAATCGGAGG - Intronic
1010703256 6:79077605-79077627 CGCGCCCCGCGCCCTGCCGGCGG + Intronic
1019057384 6:169233050-169233072 CGCGCCCTGCGCAGCACAGAAGG + Intronic
1019662635 7:2233118-2233140 CGCGTCCTGCGCAAAGCCGGGGG - Exonic
1021312163 7:19108560-19108582 CCCGGCCCGCACAGAACCGCAGG - Intronic
1022091520 7:27110745-27110767 GCCGCCCCGCGCAGACCTGGTGG + Exonic
1022395998 7:29989055-29989077 CGCGGCCCGCGGAGAACCCAGGG + Intronic
1029105469 7:98171697-98171719 CACGCCCCACACAGCACCGGCGG + Intronic
1038035411 8:23682634-23682656 CGGGCCCCGCGCCGCGCCGGAGG - Exonic
1038296107 8:26291905-26291927 CGCGCCTCGCGCAGAGCCACAGG + Intronic
1049747972 8:144271005-144271027 CCCGCCCAGCGCAGCACCTGCGG + Intronic
1049879523 8:145052457-145052479 TGCGCCCCGCGTAGTTCCGGTGG + Exonic
1050472509 9:6007920-6007942 CGCGCACCGAGCCGAGCCGGCGG - Intergenic
1062382393 9:136292726-136292748 CGGGCTCCGCGCAGCACGGGAGG + Intronic
1062423351 9:136494629-136494651 CGCGGCCCCCGTAGAGCCGGGGG + Exonic
1203781004 EBV:100836-100858 CGTGCCGCGCGGGGAACCGGGGG - Intergenic
1185471536 X:386726-386748 CGCGCCCCGCCCCGCCCCGGGGG + Intronic
1185611690 X:1397144-1397166 CGCGCCCCGCCCAGAAGCAGAGG + Intergenic
1197754477 X:129984237-129984259 CGTTCCCCGCCCAGAAGCGGCGG - Intronic