ID: 1081528356

View in Genome Browser
Species Human (GRCh38)
Location 11:43942368-43942390
Sequence GCCCGAGCTGCGCCCGGACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081528356_1081528369 23 Left 1081528356 11:43942368-43942390 CCCTGTCCGGGCGCAGCTCGGGC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1081528369 11:43942414-43942436 GCTTCTCCCGGAACCCCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 88
1081528356_1081528370 26 Left 1081528356 11:43942368-43942390 CCCTGTCCGGGCGCAGCTCGGGC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1081528356_1081528365 11 Left 1081528356 11:43942368-43942390 CCCTGTCCGGGCGCAGCTCGGGC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1081528365 11:43942402-43942424 TCCGGGGCCGCGGCTTCTCCCGG 0: 1
1: 0
2: 1
3: 15
4: 158
1081528356_1081528371 27 Left 1081528356 11:43942368-43942390 CCCTGTCCGGGCGCAGCTCGGGC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1081528371 11:43942418-43942440 CTCCCGGAACCCCCGCGGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 154
1081528356_1081528363 1 Left 1081528356 11:43942368-43942390 CCCTGTCCGGGCGCAGCTCGGGC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1081528363 11:43942392-43942414 AGCCGCGTGCTCCGGGGCCGCGG 0: 1
1: 0
2: 0
3: 18
4: 156
1081528356_1081528360 -6 Left 1081528356 11:43942368-43942390 CCCTGTCCGGGCGCAGCTCGGGC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1081528360 11:43942385-43942407 TCGGGCCAGCCGCGTGCTCCGGG 0: 1
1: 0
2: 0
3: 7
4: 120
1081528356_1081528359 -7 Left 1081528356 11:43942368-43942390 CCCTGTCCGGGCGCAGCTCGGGC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1081528359 11:43942384-43942406 CTCGGGCCAGCCGCGTGCTCCGG 0: 1
1: 0
2: 0
3: 6
4: 115
1081528356_1081528361 -5 Left 1081528356 11:43942368-43942390 CCCTGTCCGGGCGCAGCTCGGGC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1081528361 11:43942386-43942408 CGGGCCAGCCGCGTGCTCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 118
1081528356_1081528368 22 Left 1081528356 11:43942368-43942390 CCCTGTCCGGGCGCAGCTCGGGC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1081528368 11:43942413-43942435 GGCTTCTCCCGGAACCCCCGCGG 0: 1
1: 0
2: 1
3: 8
4: 101
1081528356_1081528372 28 Left 1081528356 11:43942368-43942390 CCCTGTCCGGGCGCAGCTCGGGC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1081528372 11:43942419-43942441 TCCCGGAACCCCCGCGGGCGGGG 0: 1
1: 0
2: 1
3: 10
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081528356 Original CRISPR GCCCGAGCTGCGCCCGGACA GGG (reversed) Exonic
902772493 1:18653652-18653674 CCCCGACCTGTGCCTGGACATGG - Intronic
908355638 1:63323208-63323230 GCCGGAGCTGCGCCTGGACGAGG + Exonic
909873978 1:80779601-80779623 GCCCTTGCTGCCCCCGGACTGGG + Intergenic
915320167 1:155051975-155051997 GCCCGAGATGAGCCAGGAGAAGG + Intronic
1065019763 10:21494758-21494780 GCCCGACCCGCGCGCGGACTCGG + Exonic
1073137675 10:101228863-101228885 GCCCGAGCTGCCCGCGGGCTGGG - Exonic
1078245904 11:9573412-9573434 GCCCGAACACCGCCCGGACGGGG - Intergenic
1081528356 11:43942368-43942390 GCCCGAGCTGCGCCCGGACAGGG - Exonic
1081636991 11:44727640-44727662 GCCAGGGCTGCGCCCGGAAAGGG + Intronic
1084654306 11:70506244-70506266 GCCAGAGCTGCTCCTGCACAGGG + Intronic
1084739321 11:71128769-71128791 GCCCGAGCTGCCTGAGGACAGGG + Intronic
1085250473 11:75140431-75140453 GGCAGAGCAGCGCCAGGACAGGG - Intronic
1093116779 12:15221424-15221446 ACGCGAGCTGAGCCCGGCCAAGG + Intronic
1104955823 12:132465397-132465419 CCCCGACCTGCACCCAGACATGG - Intergenic
1105517578 13:21104340-21104362 GCCAGGGCTGCGCCAGGGCATGG - Intergenic
1105809160 13:23979531-23979553 GCCCGGGCTGAGCCCGGAGCAGG - Intergenic
1114522179 14:23346740-23346762 GCCCGAGGTGCTCCGGGACGGGG - Exonic
1122960899 14:105093304-105093326 GCCTGCGCGCCGCCCGGACAGGG + Intergenic
1128767851 15:70261958-70261980 GCCTGAGCTGAGCCTGGAGAAGG - Intergenic
1129862473 15:78873146-78873168 GCGCGGGCTGCGCCCTGAGAAGG + Intronic
1132974774 16:2705817-2705839 GCCCGTGCTGCTCCCGGCCTTGG + Intronic
1133220245 16:4316518-4316540 GGCCGAGCAGCGCCCGGGCCCGG + Intronic
1136369250 16:29825713-29825735 GCCCCAGCTGGGCCCAGTCAGGG - Intronic
1136546639 16:30958353-30958375 GCCCGGGCCGAGCCCGGCCACGG - Intronic
1138478219 16:57284450-57284472 GTCGGCGCTGCGCCCGGACCTGG - Exonic
1139884320 16:70197785-70197807 GCCCGAGCTTCCCCTGCACAGGG - Intergenic
1139956977 16:70697834-70697856 GCCCCAGATGCCCCCAGACATGG + Intronic
1140368196 16:74397711-74397733 GCCCGAGCTTCCCCTGCACAGGG + Intergenic
1142364234 16:89641384-89641406 GCCCCCGTTACGCCCGGACAGGG - Intergenic
1142509715 17:385947-385969 CCCCGAGCAGCGCCCGGGCCCGG - Intronic
1144680652 17:17191616-17191638 GGCCGAGCTGCGCCTGGGGAAGG - Exonic
1147139702 17:38454119-38454141 GCCCGGGCCGCGCCGGGCCAGGG + Intronic
1148610399 17:48961021-48961043 GCCTGAGCTTCGCCCAGAGAGGG + Intronic
1151671752 17:75574790-75574812 GCCCACGCTGAGCCCAGACATGG - Intronic
1152049099 17:77958810-77958832 GCCCGGGCCGCCCCCTGACAGGG + Intergenic
1152781075 17:82227672-82227694 GCCCGTGCTGCTCCCGCCCAGGG - Intergenic
1154324936 18:13383118-13383140 GCCCTAGCTGCGCCTGGCAAGGG - Intronic
1157614048 18:48976313-48976335 GCCCGAGCCGCGCCCGGCCCGGG - Intergenic
1157752962 18:50194796-50194818 GCCCGAGCCCCGCCCGGCCCGGG - Exonic
1160164092 18:76495252-76495274 GCGCCAGCTGCGCCCGGGCGCGG + Intergenic
1163329479 19:16627697-16627719 GCCCGACCTGCCCCCGGCCCGGG + Intronic
1163575738 19:18109986-18110008 CCCCGAGCTGCGCCCCGGAAGGG - Intronic
1167375383 19:49108212-49108234 GCGCGAGCGGCGCCGGGACCGGG + Exonic
1168056497 19:53867803-53867825 GCCGGAGCTGCGCCCCGCCCCGG + Intronic
927751327 2:25673283-25673305 GCTCGCGCTGCGCCGGGACTGGG - Intronic
930075554 2:47403087-47403109 CCCCGAGCGGCGTCCGGCCACGG - Exonic
931429276 2:62196334-62196356 GCTGGAGCTGCTCCCGGACAAGG + Exonic
946312984 2:218893058-218893080 GCGCGAGCCGCGCCTGGACTCGG + Exonic
1169118626 20:3082832-3082854 CCCCGAGCTGCGCCCGCCCCAGG - Intronic
1178348301 21:31851026-31851048 GCCAGAGCTGCGAGTGGACAAGG + Intergenic
1178948505 21:36966940-36966962 GCCGGGGCTGCACCCGGAGAGGG + Intronic
966592152 3:181695483-181695505 GCCCGAGCCGCGCTAGGCCAGGG + Intergenic
966762345 3:183428905-183428927 GCCCGGGCTGCGCTCCGACAAGG + Intergenic
968405467 4:336648-336670 GCCCGAGCCCCACCCGGACCCGG - Intergenic
968453821 4:687381-687403 ACCCAGGCTCCGCCCGGACAAGG + Intronic
968483666 4:848620-848642 GCCCGAGCTGCCCCCAGAGCAGG + Intergenic
968510157 4:992019-992041 GCCGGAGCTGAGCCTGGACAGGG - Intronic
971714082 4:30153380-30153402 GCCCGAGCTCAGCCAGGGCAGGG - Intergenic
985865132 5:2508714-2508736 CCCCCTGCTGCCCCCGGACATGG + Intergenic
986043272 5:4013288-4013310 GCCCCAGCTGAGCCAGGACGGGG - Intergenic
989100044 5:37814837-37814859 CCCCGAACTGCCCCCGGGCAGGG - Intronic
989103221 5:37839240-37839262 GCCCCAGATGCGCCTGGACCCGG - Intronic
999840035 5:155414736-155414758 GCCACAGCTGCTCCTGGACAGGG - Intergenic
1001146696 5:169191282-169191304 TGCCGAGCTATGCCCGGACACGG + Intronic
1002139800 5:177132182-177132204 AGCGGAGCTGCGCCGGGACACGG - Intergenic
1003968913 6:11279972-11279994 GCAGGAGCTGAGCCTGGACAAGG - Intronic
1004140564 6:13013849-13013871 GCCGGAGCAGCGCCCGGCCCCGG + Intronic
1005883236 6:30075555-30075577 GCCCGAGCTGGGCCCGGGGCTGG - Exonic
1011470293 6:87701681-87701703 GCCTCAGCTGCCCCCGGCCATGG - Exonic
1019266332 7:119390-119412 GCCCCTGCTGAGCCTGGACAAGG + Intergenic
1020796802 7:12686835-12686857 GCCCGGGCGGCGCGCGGGCAGGG + Intronic
1025177584 7:56809872-56809894 GCCGGAGCTGGGCCTGGAGAGGG + Intergenic
1025694173 7:63766367-63766389 GCCGGAGCTGGGCCTGGAGAGGG - Intergenic
1026266148 7:68797640-68797662 GCCGGAGCTGTCCCCTGACAAGG - Intergenic
1029177478 7:98675089-98675111 GGCTGAGCTGCGCCTGCACAGGG - Intergenic
1033361480 7:140641173-140641195 GCCCGAGGTGCCCCCGGCCCCGG - Intronic
1035264815 7:157684941-157684963 GTCCAAGCGGCGCCGGGACAGGG + Intronic
1037833143 8:22200939-22200961 GCCCTGGATGCGCCCGGACATGG + Intronic
1037886756 8:22599646-22599668 GCCCGAGCTCCGCGGGGACTCGG + Exonic
1039484302 8:37899256-37899278 GCCCAGGCTGCGCTCCGACACGG + Exonic
1047381964 8:124372408-124372430 GCCCGGACAGCGCCCGGAGAGGG + Exonic
1056560589 9:87726204-87726226 GGCCCAGCTGTGGCCGGACAGGG + Exonic
1057133379 9:92669985-92670007 GCCAGGGCTGCGCCTGGGCATGG - Exonic
1061294127 9:129667715-129667737 GGCCGTGCTTCTCCCGGACACGG + Intronic
1203773963 EBV:62628-62650 GCCGAAGCTGCGCCTGGAAAAGG + Intergenic
1189319962 X:40082052-40082074 ACCTGAGCTTGGCCCGGACACGG + Intronic
1190988598 X:55522645-55522667 GCCACAGCTGCGGCCGGCCACGG + Intergenic
1197288873 X:124630618-124630640 GTCAGAGCTGTGCCAGGACATGG + Intronic
1201144152 Y:11053607-11053629 GCCCGAGCTGCCTGAGGACAGGG + Intergenic