ID: 1081528357

View in Genome Browser
Species Human (GRCh38)
Location 11:43942369-43942391
Sequence GGCCCGAGCTGCGCCCGGAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 186}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081528357_1081528371 26 Left 1081528357 11:43942369-43942391 CCTGTCCGGGCGCAGCTCGGGCC 0: 1
1: 0
2: 1
3: 6
4: 186
Right 1081528371 11:43942418-43942440 CTCCCGGAACCCCCGCGGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 154
1081528357_1081528369 22 Left 1081528357 11:43942369-43942391 CCTGTCCGGGCGCAGCTCGGGCC 0: 1
1: 0
2: 1
3: 6
4: 186
Right 1081528369 11:43942414-43942436 GCTTCTCCCGGAACCCCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 88
1081528357_1081528360 -7 Left 1081528357 11:43942369-43942391 CCTGTCCGGGCGCAGCTCGGGCC 0: 1
1: 0
2: 1
3: 6
4: 186
Right 1081528360 11:43942385-43942407 TCGGGCCAGCCGCGTGCTCCGGG 0: 1
1: 0
2: 0
3: 7
4: 120
1081528357_1081528365 10 Left 1081528357 11:43942369-43942391 CCTGTCCGGGCGCAGCTCGGGCC 0: 1
1: 0
2: 1
3: 6
4: 186
Right 1081528365 11:43942402-43942424 TCCGGGGCCGCGGCTTCTCCCGG 0: 1
1: 0
2: 1
3: 15
4: 158
1081528357_1081528370 25 Left 1081528357 11:43942369-43942391 CCTGTCCGGGCGCAGCTCGGGCC 0: 1
1: 0
2: 1
3: 6
4: 186
Right 1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1081528357_1081528361 -6 Left 1081528357 11:43942369-43942391 CCTGTCCGGGCGCAGCTCGGGCC 0: 1
1: 0
2: 1
3: 6
4: 186
Right 1081528361 11:43942386-43942408 CGGGCCAGCCGCGTGCTCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 118
1081528357_1081528359 -8 Left 1081528357 11:43942369-43942391 CCTGTCCGGGCGCAGCTCGGGCC 0: 1
1: 0
2: 1
3: 6
4: 186
Right 1081528359 11:43942384-43942406 CTCGGGCCAGCCGCGTGCTCCGG 0: 1
1: 0
2: 0
3: 6
4: 115
1081528357_1081528368 21 Left 1081528357 11:43942369-43942391 CCTGTCCGGGCGCAGCTCGGGCC 0: 1
1: 0
2: 1
3: 6
4: 186
Right 1081528368 11:43942413-43942435 GGCTTCTCCCGGAACCCCCGCGG 0: 1
1: 0
2: 1
3: 8
4: 101
1081528357_1081528372 27 Left 1081528357 11:43942369-43942391 CCTGTCCGGGCGCAGCTCGGGCC 0: 1
1: 0
2: 1
3: 6
4: 186
Right 1081528372 11:43942419-43942441 TCCCGGAACCCCCGCGGGCGGGG 0: 1
1: 0
2: 1
3: 10
4: 88
1081528357_1081528363 0 Left 1081528357 11:43942369-43942391 CCTGTCCGGGCGCAGCTCGGGCC 0: 1
1: 0
2: 1
3: 6
4: 186
Right 1081528363 11:43942392-43942414 AGCCGCGTGCTCCGGGGCCGCGG 0: 1
1: 0
2: 0
3: 18
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081528357 Original CRISPR GGCCCGAGCTGCGCCCGGAC AGG (reversed) Exonic
900014531 1:138920-138942 GGCAGGAGCTGGGCCTGGACAGG + Intergenic
900044396 1:494122-494144 GGCAGGAGCTGGGCCTGGACAGG + Intergenic
900065803 1:729028-729050 GGCAGGAGCTGGGCCTGGACAGG + Intergenic
901453342 1:9349383-9349405 GGCCAGAGCTGTGCCGGGCCAGG + Intronic
901631804 1:10651634-10651656 GGGCCGAGCTGGGTCCGGAAGGG + Intronic
905644772 1:39617453-39617475 GGCCCTTGCTGCTCCCGGCCTGG + Intergenic
907297132 1:53462405-53462427 GGCTCGAGCTTCACCCGGGCAGG + Intronic
908355672 1:63323313-63323335 GGCCGGAGCCGGGGCCGGACCGG + Exonic
909873977 1:80779600-80779622 TGCCCTTGCTGCCCCCGGACTGG + Intergenic
913222041 1:116667580-116667602 GGCGCGGGCGGCGCCCGGAGGGG - Intronic
913958191 1:143321622-143321644 GCCCAGAGCTGGGCCAGGACAGG + Intergenic
914052506 1:144146997-144147019 GCCCAGAGCTGGGCCAGGACAGG + Intergenic
914126691 1:144819544-144819566 GCCCAGAGCTGGGCCAGGACAGG - Intergenic
920641008 1:207752043-207752065 GGCCCGAGCCGCGCCCGGGGCGG - Exonic
922734940 1:227973749-227973771 GGCCCAAGCTGGGCCTGGAGAGG - Intergenic
924090109 1:240492943-240492965 GGGCTGAGCTGCGTCCGGCCCGG + Exonic
1066733198 10:38451428-38451450 GGCCGGAGCTGGGCCTGGAGAGG - Intergenic
1072637168 10:97185616-97185638 AGCCAGAGCTCCGGCCGGACCGG + Exonic
1073137676 10:101228864-101228886 CGCCCGAGCTGCCCGCGGGCTGG - Exonic
1073146326 10:101284332-101284354 GGCTCCAGCTGCGCGCGGAGCGG - Intergenic
1076889475 10:133276731-133276753 GCCCCGCGCTGCGCCCGGGACGG + Intronic
1076970727 11:130597-130619 GGCAGGAGCTGGGCCTGGACAGG + Intergenic
1077298471 11:1836788-1836810 GGCCTGAGCTGGGCACGTACCGG - Exonic
1077479615 11:2807558-2807580 GGCCCGAGGAGGGCCCGGCCCGG - Intronic
1078059048 11:8031842-8031864 GGCCCGAGCAGAGGCCAGACTGG - Intronic
1078245905 11:9573413-9573435 CGCCCGAACACCGCCCGGACGGG - Intergenic
1081528357 11:43942369-43942391 GGCCCGAGCTGCGCCCGGACAGG - Exonic
1081636990 11:44727639-44727661 GGCCAGGGCTGCGCCCGGAAAGG + Intronic
1081873255 11:46392520-46392542 GGTCCAGGCTGCGCCTGGACTGG - Intergenic
1082260068 11:50071767-50071789 GGCCGGAGCTGGGCCTGGAGAGG + Intergenic
1083303742 11:61752513-61752535 GGCCCGCGCCGCGCCCAGCCCGG - Intergenic
1085250474 11:75140432-75140454 GGGCAGAGCAGCGCCAGGACAGG - Intronic
1085763630 11:79263218-79263240 GGCCAGAGCAGAGCCCTGACGGG - Intronic
1089687999 11:120169196-120169218 GACCCGAGGGGCGCGCGGACTGG + Intronic
1091277553 11:134362711-134362733 GGCCCGAGCTGCTGCGGGAGTGG - Intronic
1094486100 12:30926909-30926931 GTCCCGAGCTTCCCCCGGGCGGG + Intronic
1102278277 12:111599158-111599180 GGCCGGAGGGGCGCCCGGGCTGG + Exonic
1103561288 12:121794366-121794388 GGGCCAACCTGCGCCCGGAGCGG - Intronic
1103764499 12:123271169-123271191 GGCCCGGGCCGCGCCGGGAGCGG - Intronic
1103822886 12:123712540-123712562 GGGCCGACCCGCGCCCGGAGGGG - Exonic
1104568216 12:129903713-129903735 GGCTCCAGCTGCTCCCGGGCTGG + Intergenic
1104692772 12:130839138-130839160 GTCCCGAGCTGCCTCCGGCCGGG + Exonic
1108408747 13:50127632-50127654 GGCCCGAGCTGCGCAGAAACTGG + Intronic
1109563374 13:64078744-64078766 GGCTGCAGCTGCGCCCGGAAGGG + Intergenic
1112041839 13:95554495-95554517 GGCCCGATCTGCCCCCAAACAGG - Intronic
1113311830 13:109140249-109140271 GGCCAGAGCTGCGGCAGGAAAGG - Exonic
1114522180 14:23346741-23346763 TGCCCGAGGTGCTCCGGGACGGG - Exonic
1117092965 14:52268542-52268564 GTGCCGAGCCGCGCGCGGACGGG + Exonic
1119870987 14:78016974-78016996 GGCCCGAGCTGCTAGAGGACTGG - Intergenic
1120993500 14:90397947-90397969 GGGCCGCCCTGCGCCCGGGCGGG + Intronic
1122743753 14:103886289-103886311 TGCCTGAGTTGCGCCCGAACTGG + Intergenic
1202930206 14_KI270725v1_random:28526-28548 GCCCAGAGCTGGGCCAGGACAGG - Intergenic
1123422169 15:20142974-20142996 GCCCAGAGCTGGGCCAGGACAGG + Intergenic
1123442906 15:20303643-20303665 GCCCAGAGCTGGGCCAGGACAGG - Intergenic
1123531397 15:21149514-21149536 GCCCAGAGCTGGGCCAGGACAGG + Intergenic
1128161054 15:65422998-65423020 GGCCCGAGCTGGGGCCGGCGCGG + Exonic
1128322252 15:66702090-66702112 GGCCCGAGCTCGGCCCGCCCCGG + Intergenic
1132582815 16:693347-693369 GGCCTGAACTGAGCCCGGCCGGG + Exonic
1132639263 16:970400-970422 CCCCCGACCTGCGCACGGACGGG + Intronic
1138688756 16:58748930-58748952 GCCCCGCGCTGCGCTCGGAGTGG + Intergenic
1139778287 16:69330601-69330623 GCCCCGCGCTGCGGCCGGAAGGG - Intronic
1141132557 16:81445582-81445604 GGCCCGAGATGCGCCCTCCCTGG + Intronic
1141963338 16:87424291-87424313 GGCCCGTGGTGCGCCCGCCCAGG + Intronic
1141989669 16:87602739-87602761 GGCCTGAGCTGCCCCCCGCCCGG + Intronic
1142449522 16:90166886-90166908 GGCAGGAGCTGGGCCTGGACAGG - Intergenic
1144021092 17:11240818-11240840 CGGCCGAGCTGCGCCTGGAGGGG + Intergenic
1144021216 17:11241238-11241260 GGCGCGCGGTGCGCACGGACCGG - Intergenic
1145037005 17:19548188-19548210 GGCCCTGGCTGCACCCAGACAGG - Intronic
1146646614 17:34580856-34580878 GCCCGGAGCTGCGCCCCCACCGG + Exonic
1146908360 17:36632268-36632290 GGCCCAAGCTGCACCCTGCCTGG - Intergenic
1148207379 17:45787598-45787620 GGCCACAGCTGTGCCCAGACAGG - Intronic
1148685106 17:49496530-49496552 AGCCAGAGCTGCGCGCGGCCAGG - Intronic
1152061087 17:78075757-78075779 GGGCTGAGCTGTGACCGGACTGG - Intronic
1152774880 17:82194910-82194932 GGACCGGGCTGCGCCCGGCATGG + Intronic
1152781076 17:82227673-82227695 GGCCCGTGCTGCTCCCGCCCAGG - Intergenic
1157614049 18:48976314-48976336 GGCCCGAGCCGCGCCCGGCCCGG - Intergenic
1157752963 18:50194797-50194819 GGCCCGAGCCCCGCCCGGCCCGG - Exonic
1160860154 19:1234276-1234298 GGCCCCAGCTCCGCCCTGCCAGG - Exonic
1160865432 19:1253953-1253975 GCCCCCAGCGGCGCCCGGGCCGG + Intronic
1160903071 19:1438785-1438807 CGCCCGATCCGCGCCCGCACAGG + Exonic
1161170038 19:2808006-2808028 GGGCAGAGCTGCGCCCTGTCGGG - Intronic
1161356488 19:3822031-3822053 GGCCCTAGCACAGCCCGGACGGG + Intronic
1161628593 19:5340234-5340256 GGCCCCGGCGGCGCCCGGCCCGG - Intronic
1163329478 19:16627696-16627718 TGCCCGACCTGCCCCCGGCCCGG + Intronic
1165075326 19:33277120-33277142 AGCCCCAGCTGTGCCCGAACCGG + Intergenic
1165204606 19:34172793-34172815 GCCCCGAGCGGCGCCCGGCTCGG - Intronic
1166762942 19:45235868-45235890 GGCCCGAACTGCTCCAGGGCTGG - Intronic
1166960378 19:46493242-46493264 GGCCCGGGTTGCCCCCGGAGGGG - Exonic
1167002167 19:46752172-46752194 GGCCTGAGCAGAGCCAGGACAGG + Intronic
1167375382 19:49108211-49108233 AGCGCGAGCGGCGCCGGGACCGG + Exonic
1168465128 19:56595495-56595517 GGACCGAGGTGCGCCTGGAGAGG + Intronic
1202691904 1_KI270712v1_random:99421-99443 GCCCAGAGCTGGGCCAGGACAGG + Intergenic
925893936 2:8457145-8457167 CGTCCGGGCTGCGCCCCGACAGG - Intergenic
927751328 2:25673284-25673306 AGCTCGCGCTGCGCCGGGACTGG - Intronic
927997280 2:27495006-27495028 GGGCCGAGCTGCGGGCGGAGCGG + Exonic
928320877 2:30282107-30282129 GGCTCCAGCTGCCCCCAGACAGG + Intronic
933954489 2:87354535-87354557 GCCCAGAGCTGGGCCAGGACAGG - Intergenic
934238682 2:90250755-90250777 GCCCAGAGCTGGGCCAGGACAGG - Intergenic
934274511 2:91565955-91565977 GCCCAGAGCTGGGCCAGGACAGG + Intergenic
934461104 2:94214086-94214108 GCCCAGAGCTGGGCCAGGACCGG - Intergenic
935265104 2:101387176-101387198 GGCCCGGGCGGCGCCCGCCCGGG + Exonic
935837396 2:107069827-107069849 GGACCTAGCTGCACCCAGACAGG + Intergenic
937958483 2:127437358-127437380 GCCCAGAGCTGAGCCCAGACAGG + Intronic
948046975 2:234952258-234952280 GGCACGATCTGCGCCCGCAAGGG - Intronic
948159379 2:235811733-235811755 GGCCAGAGCTGGGCCGGGCCGGG - Intronic
1172292661 20:33787618-33787640 GGCAAGAGCTGCCCCAGGACGGG + Intronic
1175872899 20:62216794-62216816 GGATGGAGCTGCCCCCGGACAGG + Exonic
1176159463 20:63641084-63641106 GGACCCAGCCGCGCCCGGCCTGG + Exonic
1176232291 20:64038632-64038654 GGCCCAAGATGCGCCCTGCCCGG + Intronic
1176592219 21:8657108-8657130 GCCCAGAGCTGGGCCAGGACAGG - Intergenic
1177871036 21:26573093-26573115 GGCCCGGGACGCGCCCGGCCCGG - Exonic
1180037342 21:45256640-45256662 GACCAGAGCTGCCCCCGGGCTGG + Intergenic
1180275070 22:10634237-10634259 GCCCAGAGCTGGGCCAGGACAGG - Intergenic
1180843646 22:18970463-18970485 GGCCCGAGCCCCGCCCGAGCCGG + Intergenic
1181778971 22:25179055-25179077 GGACCCAGCCGCGCCCGGCCTGG + Intronic
1184840620 22:47050587-47050609 GGCCCAAGCGGCGCCTGGAGAGG - Intronic
1185398555 22:50604578-50604600 GGCCCGGGCTGCGCGGGGCCGGG - Exonic
950316321 3:12004670-12004692 GGCCGAGGCGGCGCCCGGACCGG - Exonic
954277918 3:49554554-49554576 GGGTCGCGCTGCGCCCGGGCCGG - Exonic
959085759 3:101849498-101849520 GTCCCGCGCCGCGCCCGTACTGG + Exonic
963081854 3:141402265-141402287 GGGCCGACCTCCTCCCGGACGGG + Intronic
968510158 4:992020-992042 GGCCGGAGCTGAGCCTGGACAGG - Intronic
968965061 4:3765669-3765691 GGGCCGAGCGGCGGCCGGCCTGG - Intergenic
969609048 4:8216901-8216923 GGCCACAGCTGCGCCCAGTCCGG + Intronic
979259532 4:118634375-118634397 GGCCGGAGCTGGGCCTGGAGAGG - Intergenic
979259557 4:118634470-118634492 GGCCGGAGCTGGGCCCGGGGAGG - Intergenic
983656573 4:170090299-170090321 CTCCCGAGCTGCGCCCAGCCGGG + Intronic
986043273 5:4013289-4013311 TGCCCCAGCTGAGCCAGGACGGG - Intergenic
989100046 5:37814838-37814860 GCCCCGAACTGCCCCCGGGCAGG - Intronic
999840036 5:155414737-155414759 GGCCACAGCTGCTCCTGGACAGG - Intergenic
999960731 5:156753224-156753246 GGCCGGAGCTGGGCCGGGCCAGG - Intronic
1001295355 5:170495275-170495297 GGCCCCAGCTGCGACCTGAATGG - Intronic
1002160179 5:177310398-177310420 GCCCCCCACTGCGCCCGGACTGG - Intronic
1002296129 5:178232348-178232370 GGCCGGGGCAGCGGCCGGACGGG + Intronic
1002729447 5:181324807-181324829 GGCAGGAGCTGGGCCTGGACAGG - Intergenic
1018767261 6:166944432-166944454 GGACAGAGCTGCGCCCACACAGG - Intronic
1019342992 7:517315-517337 GCCCCGAGCTGGGGCCGGGCGGG - Intronic
1019343601 7:519564-519586 GGGCCGCGCTGTGCCCGGCCGGG - Intronic
1019359883 7:599218-599240 GGCCCGCACTGCGCCGGGAGTGG - Intronic
1020347761 7:7183158-7183180 GGCGCGCAGTGCGCCCGGACCGG + Intronic
1024648353 7:51386681-51386703 GGCCAGAGCTGGGCCTGGAGAGG + Intergenic
1025176313 7:56804141-56804163 GGCCGGAGCTGGGCCTGGAGAGG - Intergenic
1025176396 7:56804439-56804461 TGCCAGAGCTGGGCCCGTACAGG - Intergenic
1025177583 7:56809871-56809893 GGCCGGAGCTGGGCCTGGAGAGG + Intergenic
1025178180 7:56812342-56812364 GGCCGGAGCTGGGCCTGGAGAGG + Intergenic
1025179050 7:56815874-56815896 GGCCGGAGCTGGGCCTGGAGAGG + Intergenic
1025179505 7:56817760-56817782 GGCCGGAGCTGGGCCTGGAGAGG + Intergenic
1025179955 7:56819598-56819620 GGCCGGAGCTGGGCCTGGAGAGG + Intergenic
1025181300 7:56825169-56825191 GGCCGGAGCTGGGCCTGGAGAGG + Intronic
1025181746 7:56827007-56827029 GGCCGGAGCTGGGCCTGGAGAGG + Intronic
1025690171 7:63749988-63750010 GGCCGGAGCTGGGCCTGGAGAGG - Intergenic
1025690618 7:63751811-63751833 GGCCGGAGCTGGGCCTGGAGAGG - Intergenic
1025691069 7:63753634-63753656 GGCCGGAGCTGGGCCTGGAGAGG - Intergenic
1025691503 7:63755410-63755432 GGCCGGAGCTGGGCCTGGAGAGG - Intergenic
1025691943 7:63757233-63757255 GGCCGGAGCTGGGCCTGGAGAGG - Exonic
1025692392 7:63759056-63759078 GGCCGGAGCTGGGCCTGGAGAGG - Intergenic
1025692836 7:63760879-63760901 GGCCGGAGCTGGGCCTGGAGAGG - Intergenic
1025693252 7:63762558-63762580 GGCCGGAGCTGGGCCTGGAGAGG - Intergenic
1025693695 7:63764381-63764403 GGCCGGAGCTGGGCCTGGAGAGG - Intergenic
1025694174 7:63766368-63766390 GGCCGGAGCTGGGCCTGGAGAGG - Intergenic
1025695393 7:63771947-63771969 AGCCAGAGCTGGGCCCGTACAGG + Intergenic
1025912693 7:65840771-65840793 GGCAGGAGCTGGGCCTGGACAGG - Intergenic
1025912803 7:65841291-65841313 GGCATGAGCTGGGCCTGGACAGG - Intergenic
1026045730 7:66904296-66904318 GGCACGAGCTGGGCCTGGAGGGG - Intergenic
1026045809 7:66904532-66904554 GGCACGAGCTGGGCCCGGAGGGG - Intergenic
1027202493 7:76072597-76072619 GGCACGAGCCGGGCCCGGAGAGG + Intergenic
1029177479 7:98675090-98675112 GGGCTGAGCTGCGCCTGCACAGG - Intergenic
1029494523 7:100889827-100889849 GGCGCGAGCTCCGCCCGGCAGGG + Intergenic
1029521231 7:101063970-101063992 GACCCGAGGTGAGCCCGGAGGGG - Intergenic
1032051517 7:128653438-128653460 GGCAAGAGCTGCGCCTGGAGAGG - Intergenic
1032051759 7:128654365-128654387 GGCCGGAGCTGGGCCTGGAGAGG - Intergenic
1032546933 7:132751473-132751495 GGTCCTGGCTGTGCCCGGACTGG - Intergenic
1034534785 7:151719960-151719982 GGCCAGAGCTGCCCCTGGTCTGG - Intronic
1035187656 7:157139019-157139041 GGCCCGAGCTGTGGCCGGCGTGG + Exonic
1035264814 7:157684940-157684962 GGTCCAAGCGGCGCCGGGACAGG + Intronic
1043573560 8:81631185-81631207 GCCCCGAGCTGCGCCCTGAGAGG + Intergenic
1047381963 8:124372407-124372429 GGCCCGGACAGCGCCCGGAGAGG + Exonic
1053691588 9:40589746-40589768 GCCCAGAGCTGGGCCAGGACCGG - Intergenic
1054273214 9:63047739-63047761 GCCCAGAGCTGGGCCAGGACCGG + Intergenic
1054302844 9:63390712-63390734 GCCCAGAGCTGGGCCAGGACCGG - Intergenic
1054401625 9:64717228-64717250 GCCCAGAGCTGGGCCAGGACCGG - Intergenic
1054435228 9:65201537-65201559 GCCCAGAGCTGGGCCAGGACCGG - Intergenic
1054495162 9:65820144-65820166 GCCCAGAGCTGGGCCAGGACCGG + Intergenic
1056167855 9:83956357-83956379 GGCCAGAGCTGCGCGTGGAGGGG - Exonic
1060283499 9:122228893-122228915 GGCCGGGGCTGCGCGCGGGCCGG - Intronic
1060518415 9:124280073-124280095 GGCCCCAGCTGACCCTGGACAGG - Intronic
1062022312 9:134325494-134325516 GGCCCGAGCTGTCCCGGGGCAGG + Intronic
1062022689 9:134326758-134326780 GGTCCGAGCGGGGCCCGGGCCGG - Intronic
1062389350 9:136327790-136327812 GGCCGGGGCTGGGACCGGACCGG + Intronic
1203577418 Un_KI270745v1:20076-20098 GGCAGGAGCTGGGCCTGGACAGG - Intergenic
1203622272 Un_KI270749v1:135955-135977 GCCCAGAGCTGGGCCAGGACAGG - Intergenic
1187698157 X:21941086-21941108 GCCCCGAGCTGCGGCCGGGACGG - Intronic
1196707226 X:118727310-118727332 GGCCCAGGCAGCGCCCGGAGTGG + Intergenic
1199976659 X:152898295-152898317 GTCCCCAGCTGGGCACGGACTGG - Intergenic