ID: 1081528358

View in Genome Browser
Species Human (GRCh38)
Location 11:43942374-43942396
Sequence CGGCTGGCCCGAGCTGCGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 211}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081528358_1081528368 16 Left 1081528358 11:43942374-43942396 CCGGGCGCAGCTCGGGCCAGCCG 0: 1
1: 0
2: 2
3: 18
4: 211
Right 1081528368 11:43942413-43942435 GGCTTCTCCCGGAACCCCCGCGG 0: 1
1: 0
2: 1
3: 8
4: 101
1081528358_1081528363 -5 Left 1081528358 11:43942374-43942396 CCGGGCGCAGCTCGGGCCAGCCG 0: 1
1: 0
2: 2
3: 18
4: 211
Right 1081528363 11:43942392-43942414 AGCCGCGTGCTCCGGGGCCGCGG 0: 1
1: 0
2: 0
3: 18
4: 156
1081528358_1081528370 20 Left 1081528358 11:43942374-43942396 CCGGGCGCAGCTCGGGCCAGCCG 0: 1
1: 0
2: 2
3: 18
4: 211
Right 1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1081528358_1081528372 22 Left 1081528358 11:43942374-43942396 CCGGGCGCAGCTCGGGCCAGCCG 0: 1
1: 0
2: 2
3: 18
4: 211
Right 1081528372 11:43942419-43942441 TCCCGGAACCCCCGCGGGCGGGG 0: 1
1: 0
2: 1
3: 10
4: 88
1081528358_1081528371 21 Left 1081528358 11:43942374-43942396 CCGGGCGCAGCTCGGGCCAGCCG 0: 1
1: 0
2: 2
3: 18
4: 211
Right 1081528371 11:43942418-43942440 CTCCCGGAACCCCCGCGGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 154
1081528358_1081528365 5 Left 1081528358 11:43942374-43942396 CCGGGCGCAGCTCGGGCCAGCCG 0: 1
1: 0
2: 2
3: 18
4: 211
Right 1081528365 11:43942402-43942424 TCCGGGGCCGCGGCTTCTCCCGG 0: 1
1: 0
2: 1
3: 15
4: 158
1081528358_1081528369 17 Left 1081528358 11:43942374-43942396 CCGGGCGCAGCTCGGGCCAGCCG 0: 1
1: 0
2: 2
3: 18
4: 211
Right 1081528369 11:43942414-43942436 GCTTCTCCCGGAACCCCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081528358 Original CRISPR CGGCTGGCCCGAGCTGCGCC CGG (reversed) Exonic
900072070 1:778932-778954 AGTCTGGCCCTTGCTGCGCCCGG - Intergenic
901138706 1:7014109-7014131 CGGCTGGCTGGGGCAGCGCCTGG + Intronic
901631802 1:10651629-10651651 AGGCTGGGCCGAGCTGGGTCCGG + Intronic
903466304 1:23554714-23554736 CCGCTGCCCCCAGCTGCGCTCGG - Intergenic
905181142 1:36167639-36167661 GGGCTTGCCCGAGGTTCGCCGGG + Intronic
905463108 1:38134097-38134119 TGGCCGGCCCCAGCTGCTCCGGG - Intergenic
905626278 1:39492135-39492157 CGGGTAGCCCGAGCACCGCCAGG - Exonic
906117910 1:43367837-43367859 GGGCTGGGCCGGGCTGGGCCGGG + Intronic
906511174 1:46411196-46411218 GAGCTGACCTGAGCTGCGCCAGG + Intronic
913468999 1:119171647-119171669 CAGCTGGCCCCACCTGCCCCAGG + Intergenic
915340635 1:155174885-155174907 CCGCAGGCCGGAGCTGCGGCAGG + Intronic
916725211 1:167517235-167517257 GCGCTGGCCCGGGCTGTGCCTGG + Intronic
917746961 1:178019138-178019160 CTGCTGGCCCCACCTGCCCCAGG - Intergenic
920641011 1:207752048-207752070 GGCGTGGCCCGAGCCGCGCCCGG - Exonic
922267004 1:223992887-223992909 AGTCTGGCCCTTGCTGCGCCCGG - Intergenic
922734941 1:227973754-227973776 CGGGAGGCCCAAGCTGGGCCTGG - Intergenic
922750262 1:228066930-228066952 AGGCTTCCCCGAGCTGGGCCTGG - Intergenic
923744362 1:236686645-236686667 CGGTTGGCCGGGGCTGCGGCGGG - Exonic
1063241642 10:4175753-4175775 CAGGTGGCCTGAGCTGCTCCAGG - Intergenic
1065189368 10:23196171-23196193 AGGGAGGCCCGAGCTGCGCTGGG + Intergenic
1066391617 10:34981354-34981376 CTGCTGACCTGAGCTGTGCCTGG - Intergenic
1066726693 10:38402707-38402729 AGTCTGGCCCTTGCTGCGCCCGG + Intergenic
1067546436 10:47195723-47195745 AGGCTGGCCCGAGCAGTGCTGGG - Intergenic
1074313298 10:112340961-112340983 CGGCTGGGCCCAGCTGGGCAGGG - Intergenic
1074522632 10:114239494-114239516 CCCCTGGCCCGAGCCGCGCCCGG + Exonic
1077094743 11:794538-794560 CGGCTGGCCCCAGCTGGCCCTGG - Intronic
1077283652 11:1756549-1756571 CTCCTGCCCTGAGCTGCGCCTGG - Intronic
1077637818 11:3855562-3855584 GGGCTGGCCCGGGCTTCGCTGGG + Intronic
1081528358 11:43942374-43942396 CGGCTGGCCCGAGCTGCGCCCGG - Exonic
1082260067 11:50071762-50071784 CGGGAGGCCGGAGCTGGGCCTGG + Intergenic
1083757518 11:64799629-64799651 CGGCTGGGCCGTGCTGCCCCCGG + Exonic
1084178658 11:67436061-67436083 CTGCAGGCCCGAGCTGAGCTGGG - Exonic
1084275003 11:68046874-68046896 CAGCTGGCCCGTGCTGCCCGTGG + Intronic
1084733938 11:71092421-71092443 CGGCTGGCACGAGATCCACCAGG - Intronic
1085280346 11:75325909-75325931 CAGCCGGCCCGAGTTGGGCCTGG - Intronic
1085671093 11:78465189-78465211 CGGCGGGCCCCACCTGCTCCGGG - Intronic
1091295939 11:134474105-134474127 GGACTGGCCCCAGCTGCACCAGG - Intergenic
1091473904 12:753374-753396 CCGCTGGGCCCAGCTGCGGCGGG - Exonic
1091550260 12:1530894-1530916 GGGCCGGGCCGAGCGGCGCCCGG + Intronic
1096870293 12:54588504-54588526 CGGTGGGCCCGCGCTGCGGCGGG + Exonic
1101910546 12:108857599-108857621 CGGCCGGGCCGAGCCGGGCCGGG + Intergenic
1114037854 14:18646270-18646292 CGGCTCTCCCGAGCTGCCCCTGG + Intergenic
1114120767 14:19668758-19668780 CGGCTCTCCCGAGCTGCCCCTGG - Intergenic
1114267490 14:21081539-21081561 CGGCTGGCAGGAGCTGGGCCGGG + Exonic
1118389906 14:65287383-65287405 CGGCTGTCCCGAGCACGGCCTGG - Intergenic
1120993496 14:90397942-90397964 CGGCCGGGCCGCCCTGCGCCCGG + Intronic
1121731796 14:96192574-96192596 AGGCTGCCCAGAGCTGCCCCCGG - Intergenic
1123059928 14:105590031-105590053 CGGCTGGGCCGGGCTGAGCTGGG - Intergenic
1123059945 14:105590101-105590123 CGGCTGGGCCGGGCTGAGCTGGG - Intergenic
1123084412 14:105710969-105710991 GGGCTGGCCTGAGCTGGGCTGGG - Intergenic
1123084453 14:105711104-105711126 GGGCTGGGCCGGGCTGGGCCGGG - Intergenic
1125201179 15:37101699-37101721 TCCCTGGCCCGAGCTGCACCAGG + Intergenic
1130149708 15:81302062-81302084 CTGCTGGCCCCAGCTCAGCCTGG - Intronic
1132897645 16:2236571-2236593 CGGCTGCCCTGAGCTGGGGCTGG + Exonic
1133022168 16:2971546-2971568 CTGCAGGCCCTGGCTGCGCCCGG + Exonic
1133022880 16:2974577-2974599 GGGCTGGCAGCAGCTGCGCCAGG - Exonic
1133220242 16:4316512-4316534 AGGCCGGGCCGAGCAGCGCCCGG + Intronic
1136146810 16:28320944-28320966 GGGCGGGCCCGGGCTGCTCCCGG - Exonic
1136576307 16:31127366-31127388 CGGCCGGGCCGAGCTGGGCAGGG + Intronic
1137531505 16:49281497-49281519 CGGCTGGCGCGAGCAGCCCTGGG - Exonic
1139451344 16:67029820-67029842 CGGCTGGCCCGGGGCGCGCGCGG + Intronic
1142209747 16:88803439-88803461 CGGCTCCCCCGGGCAGCGCCGGG + Exonic
1203123948 16_KI270728v1_random:1560142-1560164 AGGCTGGCCAGGGCTGAGCCAGG - Intergenic
1142509719 17:385953-385975 CGACTCCCCCGAGCAGCGCCCGG - Intronic
1142676524 17:1516849-1516871 CGGCGGGCGCGGGCTGGGCCGGG - Exonic
1143011311 17:3867684-3867706 CAGCTGGTCCCAGCTGGGCCGGG + Intronic
1146283283 17:31559026-31559048 CGGGTGGCCCGCACTGCCCCGGG - Intergenic
1146286129 17:31575232-31575254 AGGCTGGCCGCAGCTGGGCCCGG + Intronic
1147554403 17:41467214-41467236 CTGCCGGCCTGAGCTGTGCCTGG - Exonic
1148848355 17:50541920-50541942 CGGCTCGCCGGCGCTGGGCCTGG + Exonic
1148852328 17:50561197-50561219 CGGCTGGCCCGGGAAGCCCCAGG + Intronic
1151384570 17:73747299-73747321 CGCCTGCCCAGAGCTGCTCCAGG - Intergenic
1152546833 17:81004340-81004362 CGGCTGGACCCGGCTGCGCGGGG + Intronic
1152834423 17:82519987-82520009 CGGCTGGGCCGTGGCGCGCCTGG + Exonic
1152935651 17:83135212-83135234 CGGCCGCCCTGAGCTCCGCCCGG - Intergenic
1153037976 18:782340-782362 CGGCTGATCCAAGCTGGGCCAGG - Intronic
1154197804 18:12279210-12279232 CTGCTGGCCCGAGGTGGGCAGGG - Intergenic
1160789763 19:918013-918035 CCGTTGGCCCGCGCTGCACCGGG - Intronic
1160904492 19:1446003-1446025 CGCGTGGGCCGAGCGGCGCCAGG - Intergenic
1161029323 19:2050657-2050679 CGGCCGGCCCGGGCAGCCCCGGG + Intronic
1161492077 19:4567662-4567684 GGGCTGGGCTGAGCTGGGCCAGG - Intergenic
1161715816 19:5875708-5875730 CGACTGGCCAGGGCTGGGCCAGG + Intronic
1162805588 19:13136452-13136474 CGGCTGGCCTGGGCTGGGCTGGG + Intronic
1163118328 19:15200950-15200972 AGGCTGGCCCGGGACGCGCCCGG - Exonic
1163266719 19:16226489-16226511 GGGCATGCCCGAGCTGCGCCTGG + Exonic
1163437764 19:17305531-17305553 CAGCTGCCACCAGCTGCGCCCGG + Intronic
1165058853 19:33195141-33195163 CGGCCCGCCCGCGCTGAGCCTGG + Intronic
1165126399 19:33600916-33600938 CAACTGGCCCTAGCTGCCCCTGG + Intergenic
1165672592 19:37692224-37692246 TCGCTGGCACAAGCTGCGCCCGG - Exonic
1165902133 19:39173928-39173950 CAGCTTGCCCGAGCTGCGCACGG - Exonic
1166084715 19:40467183-40467205 CGGCGGGGCCGAGCTGAGCCGGG + Intronic
926268066 2:11344318-11344340 GGGCTGGGCCGGGCTGGGCCGGG - Exonic
929268006 2:39940413-39940435 GGGGTGGCCTGAGCTGCACCTGG + Intergenic
929776693 2:44934829-44934851 CGGCTGGCGCGGGCTCCCCCTGG + Intergenic
930177432 2:48314932-48314954 CGGCTGTCCCGTGACGCGCCCGG + Intronic
933666895 2:84971366-84971388 CGGCCGGCGCGGGCAGCGCCGGG + Exonic
935150226 2:100427291-100427313 CGGCTGGCCTGCGCTGCCCGGGG - Intergenic
939258438 2:139775424-139775446 CAGCTGTCCTGAGCTGCTCCTGG - Intergenic
942046619 2:172102709-172102731 CAGCTGTCCCGAGCAGCGCACGG - Exonic
945119605 2:206443877-206443899 CGGCTGCCGCGAGCTGCTGCCGG - Exonic
945205914 2:207332229-207332251 CGGCTGACCCAAGCTGCGGAAGG - Intergenic
948809986 2:240469523-240469545 CGGCTGGGCTGAGCTGCTCAAGG - Intergenic
1168855041 20:1002281-1002303 CGGCCGGACCGACCCGCGCCTGG - Intergenic
1172484830 20:35291893-35291915 GGGCTGGCCCGAGGTGCCACAGG - Exonic
1174384781 20:50180777-50180799 CGGCTGGCCCGAGTGGCGGATGG - Intergenic
1175908679 20:62394337-62394359 CCGCTGGCCCGAGGTGCTCTCGG + Intronic
1175912926 20:62413284-62413306 CGGCAGGGCAGAGCTGGGCCTGG + Intronic
1176332301 21:5559868-5559890 CGGCTGGCCCCACCGGCCCCAGG - Intergenic
1176395456 21:6261083-6261105 CGGCTGGCCCCACCGGCCCCAGG + Intergenic
1176441701 21:6728021-6728043 CGGCTGGCCCCACCGGCCCCAGG - Intergenic
1176465963 21:7055090-7055112 CGGCTGGCCCCACCGGCCCCAGG - Intronic
1176489524 21:7436868-7436890 CGGCTGGCCCCACCGGCCCCAGG - Intergenic
1176547906 21:8209314-8209336 CGGACGGCCCGACCCGCGCCCGG - Intergenic
1176555802 21:8253527-8253549 CGGACGGCCCGACCCGCGCCCGG - Intergenic
1176566839 21:8392347-8392369 CGGACGGCCCGACCCGCGCCCGG - Intergenic
1176574739 21:8436561-8436583 CGGACGGCCCGACCCGCGCCCGG - Intergenic
1176611353 21:8987854-8987876 CGGACGGCCCGACCCGCGCCCGG - Intergenic
1179949079 21:44699612-44699634 CGGCCAGCCCCTGCTGCGCCTGG + Intronic
1180037340 21:45256635-45256657 CTGCTGACCAGAGCTGCCCCCGG + Intergenic
1180461981 22:15573312-15573334 CGGCTCTCCCGAGCTGCCCCTGG + Intergenic
1180581949 22:16846107-16846129 GGGCTGGCCAGGGCTGGGCCTGG - Intergenic
1182437637 22:30340939-30340961 CGGCTGGCCTCAGCTGCCCTGGG - Intronic
1183730817 22:39617494-39617516 GGGCTGGCTGGAGCTGGGCCTGG + Intronic
1184729425 22:46364686-46364708 CGGCTGGCCCGACCAGAGCCTGG - Exonic
1203252787 22_KI270733v1_random:125612-125634 CGGACGGCCCGACCCGCGCCCGG - Intergenic
1203260843 22_KI270733v1_random:170698-170720 CGGACGGCCCGACCCGCGCCCGG - Intergenic
952816587 3:37452385-37452407 CGGCTGCGCCGAGGGGCGCCGGG + Exonic
953705307 3:45226127-45226149 CGGCGCGCCCGCACTGCGCCCGG - Exonic
954063672 3:48089085-48089107 CGGTTGGGGCGAGGTGCGCCTGG + Exonic
961625710 3:128262259-128262281 GGGCTGGCCTGAGCAGCGCTGGG - Intronic
964443990 3:156740677-156740699 CGGCTGGCCCTACCGGCCCCGGG + Intergenic
966684749 3:182682310-182682332 CGTCGGGCCCTGGCTGCGCCGGG + Intergenic
968655287 4:1775915-1775937 GGGCTGGCAGGAGCAGCGCCTGG + Intergenic
968793970 4:2689787-2689809 CAGCTGGCTACAGCTGCGCCAGG - Intronic
969340169 4:6535491-6535513 GGGCTGGCTGGAGCTGTGCCGGG - Intronic
969716674 4:8871344-8871366 CGCCCGGCCCGAGCAGCGCACGG + Exonic
969720752 4:8892155-8892177 TGGCTGGCCCGTGGTGCGCCTGG - Intergenic
978463625 4:108984612-108984634 CGGCTGGCCCCACCTGCCGCGGG - Intronic
979259533 4:118634380-118634402 CGGGAGGCCGGAGCTGGGCCTGG - Intergenic
979335266 4:119454973-119454995 AGTCTGGCCCTTGCTGCGCCCGG - Intergenic
979536255 4:121823735-121823757 AGGCTGGCCTGGGCTGCGACCGG - Exonic
983254159 4:165379383-165379405 CCGCTACCCCGAGCTGCGCGAGG + Exonic
988816437 5:34839247-34839269 CGCCCGGACCGAGGTGCGCCAGG + Exonic
990448950 5:55917808-55917830 AGACTGGACAGAGCTGCGCCCGG - Intronic
991391066 5:66144198-66144220 CGGCTGGCGCGCGCAGCCCCGGG + Exonic
994083237 5:95731237-95731259 GGGCTGGCACGTGCTGCGCCCGG + Exonic
995140340 5:108728324-108728346 GGGCTGGGCCGCCCTGCGCCGGG + Intergenic
995379178 5:111512730-111512752 GGGCTGGCCCGAGCCGCGCCAGG + Intergenic
998130234 5:139648192-139648214 CAAGTGGCCCGAGCTGCGCTGGG + Intronic
998132340 5:139657738-139657760 CGGCTGGCCTGGGCTGGGACTGG + Intronic
999375803 5:151085794-151085816 AGGCTGGGCCGGGCTGGGCCTGG - Intronic
1000547600 5:162621943-162621965 CGGCTGGCCCCACCGGCTCCGGG + Intergenic
1001984357 5:176061164-176061186 TGGCTGGCCCGGGCTGCCCCAGG - Intronic
1002029326 5:176416411-176416433 CGCCTGCCCCGCGCTGCGTCCGG + Exonic
1002233120 5:177782901-177782923 GGGCTGGCCAGGGCTGCCCCAGG + Intronic
1002262860 5:178006880-178006902 GGGCTGGCCCGGGCTGCCCCAGG - Intronic
1002351990 5:178589921-178589943 CGCCTGGGCCGAGCCGCACCTGG - Exonic
1003069658 6:2935908-2935930 CGGCCGGCCCTACCTGCCCCAGG + Intergenic
1006472334 6:34235997-34236019 CGCCTGGCCCGCCCGGCGCCCGG - Intergenic
1007390328 6:41546780-41546802 CGGCGGGCCCGGGCTGCGACCGG + Exonic
1007423684 6:41734369-41734391 CGGCTGCCCCGAGCTGCTCCGGG - Intronic
1007786973 6:44286182-44286204 CGCCCGGCCGGAGCTGGGCCGGG + Exonic
1009952492 6:70413463-70413485 CGGCTGGCCCGGGCTCCCTCGGG + Exonic
1011620101 6:89234706-89234728 CGGCTGGCCCCACCAGCCCCAGG - Intergenic
1013512558 6:110858217-110858239 TGGCTGGCGCGCGCTGCGGCAGG - Intronic
1014272623 6:119350111-119350133 CGACTGGCCCGGGAGGCGCCTGG + Intergenic
1015355746 6:132275367-132275389 CTGCCGGCCCCAGCTGCACCAGG - Intergenic
1018913968 6:168121462-168121484 CGGCTGGCCTGTGGTGAGCCTGG + Intergenic
1019635319 7:2072392-2072414 CCGCTGGCCAGTGCTGCACCTGG - Intronic
1022471474 7:30684113-30684135 CAGCTGCCCAGAGCTGAGCCTGG - Intronic
1022568029 7:31423021-31423043 TAGATGGCCCGAGCTGTGCCTGG + Intergenic
1024068813 7:45768798-45768820 AGTCTGGCCCTTGCTGCGCCCGG + Intergenic
1024648352 7:51386676-51386698 CGGGAGGCCAGAGCTGGGCCTGG + Intergenic
1025176314 7:56804146-56804168 CGGGAGGCCGGAGCTGGGCCTGG - Intergenic
1025177582 7:56809866-56809888 CGGGAGGCCGGAGCTGGGCCTGG + Intergenic
1025178194 7:56812400-56812422 CGGGAGGCCCAAGCTGGGCCTGG + Intergenic
1025178628 7:56814142-56814164 CGGGAGGCCCAAGCTGGGCCTGG + Intergenic
1025179064 7:56815932-56815954 CGGGAGGCCCAAGCTGGGCCTGG + Intergenic
1025179519 7:56817818-56817840 CGGGAGGCCCAAGCTGGGCCTGG + Intergenic
1025179969 7:56819656-56819678 CGGGAGGCCCAAGCTGGGCCTGG + Intergenic
1025180443 7:56821638-56821660 CGGGAGGCCCAAGCTGGGCCTGG + Intergenic
1025180888 7:56823487-56823509 CGGGAGGCCCAAGCTGGGCCTGG + Exonic
1025181760 7:56827065-56827087 CGGGAGGCCCAAGCTGGGCCTGG + Intronic
1025690155 7:63749930-63749952 CGGGAGGCCCAAGCTGGGCCTGG - Intergenic
1025690602 7:63751753-63751775 CGGGAGGCCCAAGCTGGGCCTGG - Intergenic
1025691052 7:63753576-63753598 CGGGAGGCCCAAGCTGGGCCTGG - Intergenic
1025691487 7:63755352-63755374 CGGGAGGCCCAAGCTGGGCCTGG - Intergenic
1025691927 7:63757175-63757197 CGGGAGGCCCAAGCTGGGCCTGG - Exonic
1025692375 7:63758998-63759020 CGGGAGGCCCAAGCTGGGCCTGG - Intergenic
1025692819 7:63760821-63760843 CGGGAGGCCCAAGCTGGGCCTGG - Intergenic
1025693236 7:63762500-63762522 CGGGAGGCCCAAGCTGGGCCTGG - Intergenic
1025693679 7:63764323-63764345 CGGGAGGCCCAAGCTGGGCCTGG - Intergenic
1025694175 7:63766373-63766395 CGGGAGGCCGGAGCTGGGCCTGG - Intergenic
1026817092 7:73521779-73521801 GGGCTGGGCCGGGCTGGGCCGGG - Intronic
1026853629 7:73739243-73739265 CGGCGGGGGCGAGCGGCGCCAGG + Intergenic
1029543475 7:101198300-101198322 CGGCCTGCCCGAGCTGGGGCTGG + Exonic
1030533261 7:110736106-110736128 AGGGTGGCCCAAGCTGCACCTGG - Intronic
1031483667 7:122305224-122305246 GGGCTGGGCCGGGCTGGGCCGGG + Intronic
1034610826 7:152366868-152366890 CGTCTGGCCCTTGCTGCGCCCGG - Intronic
1034978285 7:155460330-155460352 GGGCTGGGCTGAGCTGGGCCGGG - Intronic
1035265903 7:157690266-157690288 CGGCAGGGGAGAGCTGCGCCTGG - Intronic
1035268842 7:157708052-157708074 CGGCTGGCCCCAGCGGCCCAAGG - Intronic
1035326114 7:158067296-158067318 CTGCTGGCCGGAGCAGCGGCAGG - Intronic
1036123831 8:6045278-6045300 CGGCTGGCCCCACCGGCCCCAGG - Intergenic
1037893317 8:22635707-22635729 CAGCTGTCCAGAGCTGCGCAGGG + Intronic
1039613728 8:38938513-38938535 GGGCTGGCCCTAGCCGTGCCTGG + Intronic
1039875058 8:41578194-41578216 CCGCGGGCCCAAGCTGCGTCAGG - Exonic
1039921248 8:41896038-41896060 CGGCAGGCCCGCGCTGCTCTAGG - Intronic
1045231487 8:100310439-100310461 GGGGTGGCTGGAGCTGCGCCCGG + Intronic
1045674141 8:104589216-104589238 CGGCTAGCCCGAGCGGCGCGAGG - Intergenic
1045772274 8:105756902-105756924 TGGCAGGCCCGCGCTGCCCCAGG - Intronic
1049322055 8:142001824-142001846 CAGCAGGCCCAAGCAGCGCCGGG + Intergenic
1049763970 8:144344346-144344368 CGGCTGGCAAGAGCTCCGACGGG + Intergenic
1060506224 9:124200197-124200219 GGGCTGGCCCCCGCTGCGTCAGG - Intergenic
1061537493 9:131258934-131258956 CTCCTGGCACGAGCTGGGCCCGG + Exonic
1061666076 9:132161793-132161815 CATCTGGCCCGCGCCGCGCCGGG + Intronic
1061834598 9:133320579-133320601 CGCCTGGCCTGTGCTGAGCCTGG + Intergenic
1062021132 9:134319913-134319935 CGGCTGGCCCGGCCTCCTCCTGG + Intronic
1062443362 9:136583392-136583414 GGGCTGGCCCGGGCTGGCCCAGG + Intergenic
1203429794 Un_GL000195v1:80464-80486 CGGCTGGCCCCACCGGCCCCAGG + Intergenic
1203469190 Un_GL000220v1:108763-108785 CGGACGGCCCGACCCGCGCCCGG - Intergenic
1203477011 Un_GL000220v1:152735-152757 CGGACGGCCCGACCCGCGCCCGG - Intergenic
1185792523 X:2938183-2938205 CCGCTGGCCCGGGGTGCTCCCGG - Exonic
1186768183 X:12791876-12791898 CGGCGGTCCCGAGCCGCTCCCGG + Intronic
1189281208 X:39821223-39821245 CCCCTAGCCCGAGCGGCGCCCGG - Intergenic
1189294875 X:39910960-39910982 GGGCAGGCCCGGGCTGCGCAAGG + Intergenic
1190008120 X:46759152-46759174 CGCCGGGCCGGGGCTGCGCCCGG + Intronic
1192561060 X:72128403-72128425 CTGCTGGCCTGAACTGCCCCTGG - Exonic
1196775491 X:119333694-119333716 CGGCTGGCCCGGCCGGCCCCGGG + Intergenic
1199772559 X:150983925-150983947 CTGCGGGCCCGCGCGGCGCCGGG - Intronic
1200230286 X:154440474-154440496 CGGCTTGGGCGAGCTGCCCCAGG + Exonic
1201416390 Y:13752438-13752460 CCGCTGCGCCCAGCTGCGCCCGG + Intergenic