ID: 1081528362

View in Genome Browser
Species Human (GRCh38)
Location 11:43942390-43942412
Sequence GCGGCCCCGGAGCACGCGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 201}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081528362_1081528380 24 Left 1081528362 11:43942390-43942412 CCAGCCGCGTGCTCCGGGGCCGC 0: 1
1: 0
2: 3
3: 20
4: 201
Right 1081528380 11:43942437-43942459 CGGGGCCTGCCTTCCGGAGCCGG 0: 1
1: 0
2: 1
3: 10
4: 162
1081528362_1081528368 0 Left 1081528362 11:43942390-43942412 CCAGCCGCGTGCTCCGGGGCCGC 0: 1
1: 0
2: 3
3: 20
4: 201
Right 1081528368 11:43942413-43942435 GGCTTCTCCCGGAACCCCCGCGG 0: 1
1: 0
2: 1
3: 8
4: 101
1081528362_1081528372 6 Left 1081528362 11:43942390-43942412 CCAGCCGCGTGCTCCGGGGCCGC 0: 1
1: 0
2: 3
3: 20
4: 201
Right 1081528372 11:43942419-43942441 TCCCGGAACCCCCGCGGGCGGGG 0: 1
1: 0
2: 1
3: 10
4: 88
1081528362_1081528371 5 Left 1081528362 11:43942390-43942412 CCAGCCGCGTGCTCCGGGGCCGC 0: 1
1: 0
2: 3
3: 20
4: 201
Right 1081528371 11:43942418-43942440 CTCCCGGAACCCCCGCGGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 154
1081528362_1081528379 18 Left 1081528362 11:43942390-43942412 CCAGCCGCGTGCTCCGGGGCCGC 0: 1
1: 0
2: 3
3: 20
4: 201
Right 1081528379 11:43942431-43942453 CGCGGGCGGGGCCTGCCTTCCGG 0: 1
1: 0
2: 1
3: 12
4: 151
1081528362_1081528369 1 Left 1081528362 11:43942390-43942412 CCAGCCGCGTGCTCCGGGGCCGC 0: 1
1: 0
2: 3
3: 20
4: 201
Right 1081528369 11:43942414-43942436 GCTTCTCCCGGAACCCCCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 88
1081528362_1081528381 28 Left 1081528362 11:43942390-43942412 CCAGCCGCGTGCTCCGGGGCCGC 0: 1
1: 0
2: 3
3: 20
4: 201
Right 1081528381 11:43942441-43942463 GCCTGCCTTCCGGAGCCGGTTGG 0: 1
1: 0
2: 0
3: 4
4: 105
1081528362_1081528370 4 Left 1081528362 11:43942390-43942412 CCAGCCGCGTGCTCCGGGGCCGC 0: 1
1: 0
2: 3
3: 20
4: 201
Right 1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081528362 Original CRISPR GCGGCCCCGGAGCACGCGGC TGG (reversed) Exonic
900189878 1:1348846-1348868 GCGACCCCCGAGCCCGCGCCAGG + Intronic
900349624 1:2228391-2228413 GCGGGCCCGGGGCTCGCGGGGGG - Intergenic
901641373 1:10694700-10694722 GCGGCGCGGGCGCGCGCGGCGGG - Intronic
901832097 1:11898869-11898891 GCGGCTCCCGAGCACTTGGCAGG - Intergenic
902031017 1:13422336-13422358 GCTGCTCGGGAGCACGAGGCAGG - Intergenic
902600912 1:17539763-17539785 GCGGGCCCGGACCTCGCGGGCGG + Intergenic
902693400 1:18124609-18124631 GTGGCCCCGGACCCCGTGGCTGG + Intronic
902951019 1:19882760-19882782 GCGGCGCCGGGGGACGCGCCGGG + Intronic
903883700 1:26529595-26529617 GCGGGCCGGGGGCTCGCGGCAGG + Intergenic
904500037 1:30908318-30908340 GCGGCCCCGGGGGAAGCAGCCGG + Intronic
908544247 1:65148342-65148364 GCGGCCCCGGAGGAAGCCCCGGG - Exonic
910647010 1:89524968-89524990 GCGGCCCAGGAGCACGCCGCGGG + Exonic
912354197 1:109041890-109041912 GCGGCGGAGGAGAACGCGGCTGG + Exonic
914919699 1:151838772-151838794 GCGGCCCGGCGGCACGTGGCGGG - Exonic
917817512 1:178725536-178725558 GCAGCCCCGGGGCCCGCGGCCGG - Intronic
919486861 1:198157111-198157133 GCCGCCCCGGCGGACGCTGCAGG - Exonic
921944976 1:220880032-220880054 GCGGCCCCGGAGGGCCTGGCAGG + Exonic
922200053 1:223393772-223393794 CCGGCCCCGCAGCAGGCGCCTGG + Exonic
922612452 1:226940420-226940442 ACGGCGCCTGGGCACGCGGCGGG - Intronic
922808086 1:228400969-228400991 GCAGCCCCAGAGCAGGCAGCTGG + Exonic
1062774583 10:135153-135175 GCGGGGCCGGAGCGGGCGGCGGG - Intronic
1065637560 10:27746050-27746072 CCGGCTCCGGAGGACTCGGCGGG - Exonic
1066013693 10:31217255-31217277 GCGGCCCGTGAGCACCCTGCAGG - Intergenic
1066429126 10:35336195-35336217 GCGTCCCCGGGGCCCGCAGCGGG - Intronic
1069738449 10:70672633-70672655 GGGGACCCGGAGCAGGCGGGAGG + Intergenic
1070167704 10:73911146-73911168 GCAGCCCCGGAGCCCGGGCCAGG + Exonic
1070835685 10:79445625-79445647 GCGGCCCCGGCGCGCGCAGGCGG + Exonic
1072591479 10:96832233-96832255 GCGGCCCCGGGCGACGCGGCTGG + Intergenic
1073051655 10:100671120-100671142 CCGGCCCCGGCGGAGGCGGCGGG - Intergenic
1073268301 10:102241433-102241455 GCGGCCCGGGAGCAGGGGGGCGG - Exonic
1074585967 10:114768138-114768160 GCAGCCCCGGAGCGCCCGCCCGG + Intergenic
1075334440 10:121598276-121598298 GGGCCCCCGGGGCTCGCGGCCGG + Exonic
1076373900 10:129971336-129971358 GCACCCCCGGAGCCCGCGCCAGG - Intergenic
1076554347 10:131311926-131311948 GCGGCCGCGGAGGACGTGGGTGG + Intergenic
1076792597 10:132785194-132785216 GCGGCCGCGGGGCCCGGGGCTGG + Intronic
1078594424 11:12674495-12674517 GCGGCCCCGCCGCCCGCCGCGGG + Intergenic
1079076752 11:17389221-17389243 GCCGCCCGGGCGCTCGCGGCTGG + Intronic
1081528362 11:43942390-43942412 GCGGCCCCGGAGCACGCGGCTGG - Exonic
1084489590 11:69471167-69471189 GCGGCCCCGGAGCCGGCTGCGGG + Intergenic
1084856843 11:71994857-71994879 GTGGCCCAGGAGCTCGAGGCAGG - Intronic
1090004163 11:122985009-122985031 GCAGCCCTGGGGCCCGCGGCTGG - Intergenic
1091616391 12:2053704-2053726 GCGGCCCCGGGCCACTCCGCAGG - Intronic
1091718331 12:2795306-2795328 CCGCGCCCGGAGCCCGCGGCCGG + Intronic
1092238628 12:6824522-6824544 CCGGCCCCGGAGGGCTCGGCAGG + Exonic
1094820300 12:34219223-34219245 GGAGCCCCGAAGCACGCAGCAGG - Intergenic
1096461158 12:51821932-51821954 GCGGCGCCCGAGTACGCGGCCGG - Intergenic
1099228118 12:79993300-79993322 GCGGCGCAGGAGCCCACGGCGGG + Intergenic
1100391309 12:94148357-94148379 GCGGCCGCGGCGGCCGCGGCGGG + Intergenic
1102053639 12:109880472-109880494 GCGTCCCCGGAGCCTGCGGCGGG - Exonic
1104289723 12:127456108-127456130 GCGGCCCCGGACCGCACGTCCGG - Intergenic
1104602349 12:130162311-130162333 GGGGCCCGGGAGCCCGCGGCGGG + Intergenic
1104891777 12:132143750-132143772 CCGGCCCTGGAGGAGGCGGCCGG - Exonic
1104891865 12:132144071-132144093 GCGGCCCCGGCGGCGGCGGCGGG - Exonic
1106087648 13:26557786-26557808 GCAGCCCCGGCGCCGGCGGCGGG + Exonic
1108685425 13:52815333-52815355 GCTGCCCAGGAGCCGGCGGCGGG + Intergenic
1113082826 13:106535546-106535568 GCGCGTCCGGAGCCCGCGGCGGG - Intergenic
1113310546 13:109127570-109127592 GCGAGCCCGGAACACGAGGCTGG - Intronic
1113350175 13:109521889-109521911 GCGGCCGCGGAGCCCACGCCGGG - Intergenic
1115331586 14:32203607-32203629 GCCGCCTCTGAGCGCGCGGCGGG + Intergenic
1115545470 14:34462063-34462085 CCGGCCCCCGCGCGCGCGGCCGG + Intronic
1115910870 14:38255463-38255485 GCGGCCCCGGGGCGCGGCGCAGG + Exonic
1117912572 14:60649211-60649233 ACGGCCCAGGCGCACGCGGCAGG + Exonic
1119742897 14:77026012-77026034 GCGGCGCCGGGGCACGCGGCGGG - Exonic
1120907219 14:89630923-89630945 GGGGTCCTGGAGCACTCGGCGGG - Intronic
1120993620 14:90398323-90398345 GCGGCCCCCGAGCGGGCGTCTGG - Intronic
1122238431 14:100345882-100345904 CCGGGCCCTGGGCACGCGGCTGG + Intronic
1122269934 14:100564422-100564444 GCTGCCCAGCAGCACGCTGCAGG + Intronic
1122470861 14:101965002-101965024 GCGACCCCGGAGGACCTGGCAGG - Intronic
1122940332 14:104978291-104978313 CCGGCTCCGGCGCACGGGGCGGG + Exonic
1124500438 15:30223289-30223311 GCGGCCTCGGGGCCCGCGCCGGG + Intergenic
1125541184 15:40471028-40471050 GCGGCGCCGAAGCGGGCGGCGGG - Exonic
1128149741 15:65355511-65355533 GCGAGCCCGGAGGACGCGGCGGG + Intronic
1128322630 15:66703700-66703722 GCGGCCCTGGAGCCGGCGGGCGG + Exonic
1129752780 15:78077567-78077589 GCGGCCGCGGAGCCCGGGGCGGG - Exonic
1131215109 15:90529914-90529936 GCGGCCCCGGAGCCAGCGAGCGG - Intronic
1132391988 15:101445952-101445974 GCGGCCCCGGGGCAGGGGGCTGG - Intronic
1132398209 15:101489477-101489499 GGGGGCGCGGAGCAGGCGGCAGG + Exonic
1132552761 16:560214-560236 CCGGTCCCGGCGCACGAGGCCGG + Intergenic
1132557886 16:580460-580482 ACTGCCCTGGAGCACGCAGCTGG + Intronic
1132585027 16:702352-702374 GGGGTCCCGGAGCAGGAGGCAGG - Intronic
1132642345 16:983583-983605 GAGGCTCCGGAGCGCACGGCAGG + Intronic
1134014506 16:10878978-10879000 GCGGCCCCAGAGCTGGCGGGAGG + Intronic
1136536315 16:30902028-30902050 GGGGCCCCGGAGCACGGGCAGGG - Intronic
1138503354 16:57462866-57462888 GGGGCCCCGGGGCAGGGGGCGGG + Intronic
1142610892 17:1108834-1108856 GCGGGCGCAGAGCGCGCGGCCGG - Intronic
1143750499 17:9023403-9023425 GCGGCGGCGGAGCCGGCGGCGGG + Intronic
1145273721 17:21418022-21418044 GCGGCCCTGGAAGACTCGGCAGG - Exonic
1149905865 17:60526008-60526030 GCGGCCCCGGAGGATTCGGAGGG + Exonic
1150675735 17:67245017-67245039 GCGGCCCCGGGGCAGGCTGGGGG - Intronic
1151155539 17:72121367-72121389 GCGGGCCCGGGGCAGGGGGCTGG - Exonic
1151780266 17:76240657-76240679 GCGGCCCAGGGCCTCGCGGCGGG + Intergenic
1152068144 17:78122578-78122600 GTGGCCCCGGAGCACCAAGCTGG - Intronic
1152870747 17:82751866-82751888 GCGGGGCCTGAGCACGCGGTGGG - Intergenic
1154196640 18:12271867-12271889 GCGGCCCCGCAGCCCCCGCCCGG + Intronic
1155218297 18:23662540-23662562 GAGGCCCGGGAGGAAGCGGCGGG - Intronic
1156502213 18:37566967-37566989 CCCGCCCCGGAGAGCGCGGCTGG + Intergenic
1157609985 18:48950171-48950193 GCCGCGCCGGCGCCCGCGGCTGG + Exonic
1160397598 18:78583649-78583671 GCAGCTCAGGAGCACGAGGCTGG - Intergenic
1160719291 19:590333-590355 GCGGCCTCGGGGCCCGCGCCGGG + Exonic
1161364216 19:3868868-3868890 CCGGGCCGGGCGCACGCGGCGGG + Intronic
1161504454 19:4636354-4636376 GCTTCCCCGGAACCCGCGGCCGG - Intergenic
1161952865 19:7477411-7477433 GCTGCCCCGGGGCAAGCGGAGGG - Exonic
1162250092 19:9435372-9435394 GCGGCCCCGGCGGACGCGAGCGG + Intronic
1162932106 19:13962449-13962471 GGGGCACCTGGGCACGCGGCGGG + Exonic
1163443789 19:17334742-17334764 GCAGCCGCGGAGCGCGCGGGAGG + Exonic
1163681161 19:18683489-18683511 GCGGGCCCCGAGCGCGCGCCTGG + Intergenic
1163720460 19:18896047-18896069 GCGGCGGCGGGGCCCGCGGCGGG - Exonic
1165079353 19:33298694-33298716 CAGGCCTCGGGGCACGCGGCGGG + Intergenic
1167472803 19:49684848-49684870 GCGGCCCGGGAGCTGGCGGGCGG + Intronic
1168257281 19:55173797-55173819 GGGGCCCCGGAGCTCGGGACGGG + Intronic
1168323159 19:55522283-55522305 GAGGCCCCGAAGAACGCAGCAGG + Intergenic
926089992 2:10043513-10043535 GCGGCCGCGGAGGGAGCGGCTGG - Intronic
929539686 2:42810241-42810263 GCGGCCCCAGCGCCTGCGGCCGG - Intergenic
929983184 2:46699476-46699498 GGGGCCGGGGAGCAGGCGGCGGG - Intronic
934559938 2:95307786-95307808 GCGGCCTCGGAGCCCCTGGCAGG - Intronic
934576100 2:95402565-95402587 GCGTCTCCAGAGAACGCGGCTGG + Intergenic
936072585 2:109381211-109381233 GTGGCCCTGGAGCAGGCTGCTGG + Intronic
936165400 2:110115803-110115825 GCTGCCGCGGAGCACCCGGCAGG - Exonic
940300890 2:152175699-152175721 GCGGCCGCGGGTCACCCGGCGGG - Exonic
943704420 2:191020338-191020360 GCTGGCCCGGCGCGCGCGGCGGG + Intronic
948047036 2:234952451-234952473 GCGGCCCGAGCGCACGCGGAGGG - Intronic
1168757064 20:325401-325423 GCGGCGCCCGAGCGCGAGGCGGG + Exonic
1169673833 20:8132608-8132630 GCGGCCCGGGCGAGCGCGGCAGG - Exonic
1172061509 20:32190118-32190140 GCGGTCCCGGGGCCCGCTGCGGG + Intergenic
1173495252 20:43513912-43513934 GGTGCCCCGGAGCAAGTGGCCGG + Exonic
1175851053 20:62093154-62093176 GCCGCCCCGGTGCACCTGGCAGG + Intergenic
1176164066 20:63663743-63663765 GTGGCCCCGGAGCACTCAGAAGG + Intronic
1176871223 21:14084493-14084515 GGAGCCCCGGAGCACGCAGCGGG - Intergenic
1177318750 21:19493827-19493849 GCGGCACAGGAGCCCACGGCGGG - Intergenic
1177905257 21:26966172-26966194 GCGGCGCAGGAGCAAGGGGCTGG - Exonic
1179162094 21:38907089-38907111 GCTGCCCTGGAGCACACAGCAGG - Intergenic
1180037547 21:45257526-45257548 GCGGCCCAGAGGCACTCGGCAGG - Intergenic
1180852717 22:19029601-19029623 GCGGCCCCGGATCCCGCCGGCGG - Intergenic
1180950454 22:19718418-19718440 GCGCCCGCGGAGCGCGCGGCGGG - Intronic
1181057869 22:20268379-20268401 GCGGCGCCGGTGCACCGGGCGGG - Exonic
1181064693 22:20299847-20299869 ACGGCCCCTGGGCCCGCGGCGGG - Intergenic
1181155541 22:20917733-20917755 GCGGCCCCGGAGCAGGCGGGCGG + Exonic
1182427898 22:30284500-30284522 GCGGCCCCGGAGGACAGAGCAGG + Intergenic
1183299462 22:37051804-37051826 GCGGCCGCGCCGCAGGCGGCTGG + Exonic
1183380112 22:37486397-37486419 GCGGTCCCGGAGGCTGCGGCAGG - Exonic
1183577469 22:38700991-38701013 GCGTTTCCGGAGCACGCGCCGGG - Intronic
1183744706 22:39685856-39685878 GCGGCCCCAGGGCACGCCGGGGG - Exonic
1184034288 22:41911168-41911190 GCGGCGGCGGAGCACGCGGAGGG - Intronic
1184046836 22:41977119-41977141 GCGGCCCCGGCCAGCGCGGCTGG + Intronic
1184412204 22:44331803-44331825 GCGGCGACGGGGCATGCGGCCGG - Intergenic
1185065316 22:48629103-48629125 GGGGCCCCAGAGCACCCGTCTGG - Intronic
950075079 3:10181220-10181242 GCGGCTCAGGAGCACCGGGCAGG - Intronic
952942189 3:38453794-38453816 GGGGGCGCGGACCACGCGGCCGG + Intergenic
954540593 3:51391086-51391108 GTGGCGCCAGAGCGCGCGGCCGG + Intergenic
955916507 3:63912757-63912779 GCCGCCACGGCGCACACGGCCGG + Exonic
956080251 3:65549457-65549479 GCGGCCACCGAGCGCGCGCCTGG - Intronic
956178998 3:66500588-66500610 GCCGCTCCGGAGCACCCGGCGGG + Exonic
961545276 3:127629067-127629089 GCGCGCCCGCGGCACGCGGCCGG + Intergenic
964041779 3:152269308-152269330 GCGTCCGCAGAGCCCGCGGCAGG - Intronic
967904150 3:194486936-194486958 GCGGCGCCCGATCACGCTGCGGG + Intronic
968689793 4:1984561-1984583 GCGGCCCCAGGGGACACGGCAGG - Intronic
968775465 4:2537063-2537085 GCGGCCCCGGGCAGCGCGGCAGG + Intronic
968916980 4:3500867-3500889 GCGGCCCCGTGGCCCCCGGCAGG + Intronic
969436592 4:7192613-7192635 GCGGCAGCGGAGCCGGCGGCGGG - Exonic
970408604 4:15786804-15786826 GCGGCACAGGAGCCCACGGCAGG + Intronic
973820649 4:54658891-54658913 GCCGCCCCGGGGCGCGCGGCAGG - Intronic
977694359 4:99949988-99950010 GCAGCCTCGGATCTCGCGGCGGG - Intronic
980053717 4:128061258-128061280 GCGGCCCGAGAGCACGGGGCGGG - Exonic
981782917 4:148445677-148445699 GCGGCGCGCGGGCACGCGGCAGG + Intergenic
984639262 4:182144528-182144550 GCGTCCCCGGGCCGCGCGGCCGG + Intronic
985576121 5:674284-674306 AGGGCCCAGGAGCACGGGGCTGG + Intronic
985660702 5:1155505-1155527 AGGTCCCCGGAGCGCGCGGCGGG + Intergenic
987050465 5:14143756-14143778 GCGGGGCCGGAGGACGCGGCGGG - Exonic
989261594 5:39424903-39424925 GCGGCTCCGAAGCTCCCGGCCGG - Exonic
992052797 5:72956344-72956366 GCGGCCCGGGGGCCCGCAGCGGG + Intronic
993901132 5:93584883-93584905 GCGACCCCGGGGCGCCCGGCGGG + Exonic
997654217 5:135543785-135543807 GGGGCCTCGGAGAACCCGGCGGG + Intergenic
1001826688 5:174751197-174751219 CCGCCCCGGGAGCTCGCGGCGGG - Intergenic
1002401719 5:178994853-178994875 GCGGGCCTGGCGCGCGCGGCGGG - Exonic
1002418481 5:179133158-179133180 TGGGCCCCTGTGCACGCGGCTGG + Intronic
1002455761 5:179344843-179344865 GCGGCGCCGGGGCTCGCGTCCGG - Intronic
1003076784 6:2989214-2989236 GGGGTCCAGGAGGACGCGGCTGG + Intronic
1006185253 6:32177971-32177993 GCGCCTGCGCAGCACGCGGCGGG - Intronic
1006638465 6:35476231-35476253 GCAGCCCTGGATCACCCGGCCGG + Intronic
1007336189 6:41156906-41156928 ACTGCCCTGGAGCACGAGGCAGG + Intergenic
1008895012 6:56542823-56542845 GCGGCTCCGGAACGCCCGGCAGG - Intronic
1011277444 6:85643770-85643792 GCGGCCGCGGAGCCGGGGGCGGG - Intronic
1012450635 6:99349765-99349787 CCGGCCCCGGCGGAGGCGGCCGG - Intronic
1013117644 6:107115020-107115042 GCGGCTCCGGGGCGAGCGGCCGG - Intronic
1016104689 6:140148195-140148217 GCGGCGCAGGAGCCCACGGCCGG + Intergenic
1016917735 6:149260333-149260355 GCTGCGCTGGAGCACGCGGTGGG - Intronic
1018150329 6:160931339-160931361 TCAGCCCCGGAGCCAGCGGCTGG - Intergenic
1019515634 7:1438684-1438706 GCGGGCCTGGGGCACGGGGCTGG + Intronic
1020125251 7:5529831-5529853 GCGTCCCCGCGGCGCGCGGCAGG + Intronic
1022517766 7:30986876-30986898 GCGGCTCAGCAGCACTCGGCCGG - Intronic
1023015626 7:35967424-35967446 GCGGGCCCGGAGCAGGGGGAAGG + Intergenic
1023711077 7:42993212-42993234 GCGGACCGGGAGCACCCTGCCGG - Intergenic
1026804035 7:73418413-73418435 GGGGCCCCTGAGCACGTGGTGGG - Intergenic
1028070076 7:86440651-86440673 CCGCCCCCGGAGCAGCCGGCCGG + Intergenic
1029708319 7:102286795-102286817 GCGGGGCCGGGGCTCGCGGCGGG + Intronic
1031134843 7:117873354-117873376 CGGGCCCCGGAGGACGCGGCGGG - Exonic
1035021450 7:155803350-155803372 CTGGCCCGGGCGCACGCGGCTGG + Exonic
1035168645 7:157005941-157005963 GGGGCCCAGGCGCACGCGGCCGG - Intronic
1035338151 7:158143328-158143350 GAGGCACCGGAGCCTGCGGCAGG + Intronic
1035432112 7:158829823-158829845 GTGGCCTCGGAGCCCGCGGGCGG + Intronic
1036739515 8:11347897-11347919 GCGGCTCCGGAGCCCGGCGCGGG + Intergenic
1038542490 8:28401837-28401859 GCGGCCCCGGAGCCGGAGGTGGG - Intronic
1042916171 8:73878337-73878359 GCGTCTCCGGAGAAGGCGGCTGG - Intronic
1045488649 8:102654268-102654290 GCGGGCCCGGCGCGCACGGCCGG - Intronic
1046556492 8:115779611-115779633 GAAGCCCTGGAGCAAGCGGCAGG + Intronic
1049109713 8:140635404-140635426 GCGGGCCCGGCGCGGGCGGCAGG - Intronic
1049694551 8:143976963-143976985 GAGCCCCCGGCGCACGGGGCGGG + Intergenic
1049936344 9:504687-504709 GCGGACCCGGAGCTCGGGGAAGG - Exonic
1051855476 9:21559829-21559851 GCGGCCCCGGCGGCGGCGGCAGG - Intergenic
1053050610 9:34958216-34958238 GCGGCGGCGGCGCGCGCGGCCGG - Intronic
1055461427 9:76523804-76523826 GCGGCACAGGAGCACACGGTGGG + Intergenic
1056143603 9:83707837-83707859 GGGGCCCCGGAGCTCGGTGCAGG + Exonic
1056386185 9:86099272-86099294 GCAGCCCCGGCGCAAGCCGCGGG + Intronic
1057361179 9:94374856-94374878 GCGGCGTCGGAGCCCGAGGCGGG + Exonic
1057662184 9:97013308-97013330 GCGGCGTCGGAGCCCGAGGCGGG - Exonic
1058053273 9:100427209-100427231 GTGGCCGCGGCGCGCGCGGCGGG + Intronic
1061208455 9:129177418-129177440 GGGGGCGCGGAGCAGGCGGCCGG + Exonic
1061961927 9:133992860-133992882 GCGGGGCCGGAGCACTCGCCTGG + Intergenic
1062122970 9:134843887-134843909 GCGGCTCCAGAGCTCGGGGCGGG + Exonic
1062253091 9:135608134-135608156 GTGGCCCCGCAGCATGGGGCTGG + Intergenic
1062346823 9:136118813-136118835 GCGGGCCCGGAGCAGGGGGAAGG - Exonic
1062397441 9:136358152-136358174 GGGGGCCCGGAGCAGGGGGCAGG + Exonic
1062453942 9:136627048-136627070 GCGGCCCAGGAGGGCGTGGCTGG + Intergenic
1190274569 X:48891694-48891716 CCGTCCCCTGAGCCCGCGGCGGG - Intergenic
1197533750 X:127663089-127663111 GCGGCACAGGAGCCCACGGCGGG + Intergenic