ID: 1081528366

View in Genome Browser
Species Human (GRCh38)
Location 11:43942403-43942425
Sequence TCCGGGAGAAGCCGCGGCCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 171}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081528366_1081528371 -8 Left 1081528366 11:43942403-43942425 CCGGGGCCGCGGCTTCTCCCGGA 0: 1
1: 0
2: 3
3: 10
4: 171
Right 1081528371 11:43942418-43942440 CTCCCGGAACCCCCGCGGGCGGG 0: 1
1: 0
2: 0
3: 15
4: 154
1081528366_1081528381 15 Left 1081528366 11:43942403-43942425 CCGGGGCCGCGGCTTCTCCCGGA 0: 1
1: 0
2: 3
3: 10
4: 171
Right 1081528381 11:43942441-43942463 GCCTGCCTTCCGGAGCCGGTTGG 0: 1
1: 0
2: 0
3: 4
4: 105
1081528366_1081528388 22 Left 1081528366 11:43942403-43942425 CCGGGGCCGCGGCTTCTCCCGGA 0: 1
1: 0
2: 3
3: 10
4: 171
Right 1081528388 11:43942448-43942470 TTCCGGAGCCGGTTGGCGGGGGG 0: 1
1: 0
2: 0
3: 5
4: 94
1081528366_1081528392 29 Left 1081528366 11:43942403-43942425 CCGGGGCCGCGGCTTCTCCCGGA 0: 1
1: 0
2: 3
3: 10
4: 171
Right 1081528392 11:43942455-43942477 GCCGGTTGGCGGGGGGCGGGCGG 0: 1
1: 0
2: 10
3: 130
4: 1088
1081528366_1081528384 19 Left 1081528366 11:43942403-43942425 CCGGGGCCGCGGCTTCTCCCGGA 0: 1
1: 0
2: 3
3: 10
4: 171
Right 1081528384 11:43942445-43942467 GCCTTCCGGAGCCGGTTGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 70
1081528366_1081528380 11 Left 1081528366 11:43942403-43942425 CCGGGGCCGCGGCTTCTCCCGGA 0: 1
1: 0
2: 3
3: 10
4: 171
Right 1081528380 11:43942437-43942459 CGGGGCCTGCCTTCCGGAGCCGG 0: 1
1: 0
2: 1
3: 10
4: 162
1081528366_1081528387 21 Left 1081528366 11:43942403-43942425 CCGGGGCCGCGGCTTCTCCCGGA 0: 1
1: 0
2: 3
3: 10
4: 171
Right 1081528387 11:43942447-43942469 CTTCCGGAGCCGGTTGGCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1081528366_1081528391 26 Left 1081528366 11:43942403-43942425 CCGGGGCCGCGGCTTCTCCCGGA 0: 1
1: 0
2: 3
3: 10
4: 171
Right 1081528391 11:43942452-43942474 GGAGCCGGTTGGCGGGGGGCGGG 0: 1
1: 0
2: 7
3: 46
4: 609
1081528366_1081528370 -9 Left 1081528366 11:43942403-43942425 CCGGGGCCGCGGCTTCTCCCGGA 0: 1
1: 0
2: 3
3: 10
4: 171
Right 1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1081528366_1081528379 5 Left 1081528366 11:43942403-43942425 CCGGGGCCGCGGCTTCTCCCGGA 0: 1
1: 0
2: 3
3: 10
4: 171
Right 1081528379 11:43942431-43942453 CGCGGGCGGGGCCTGCCTTCCGG 0: 1
1: 0
2: 1
3: 12
4: 151
1081528366_1081528383 18 Left 1081528366 11:43942403-43942425 CCGGGGCCGCGGCTTCTCCCGGA 0: 1
1: 0
2: 3
3: 10
4: 171
Right 1081528383 11:43942444-43942466 TGCCTTCCGGAGCCGGTTGGCGG 0: 1
1: 0
2: 0
3: 1
4: 64
1081528366_1081528390 25 Left 1081528366 11:43942403-43942425 CCGGGGCCGCGGCTTCTCCCGGA 0: 1
1: 0
2: 3
3: 10
4: 171
Right 1081528390 11:43942451-43942473 CGGAGCCGGTTGGCGGGGGGCGG 0: 1
1: 0
2: 0
3: 42
4: 584
1081528366_1081528372 -7 Left 1081528366 11:43942403-43942425 CCGGGGCCGCGGCTTCTCCCGGA 0: 1
1: 0
2: 3
3: 10
4: 171
Right 1081528372 11:43942419-43942441 TCCCGGAACCCCCGCGGGCGGGG 0: 1
1: 0
2: 1
3: 10
4: 88
1081528366_1081528386 20 Left 1081528366 11:43942403-43942425 CCGGGGCCGCGGCTTCTCCCGGA 0: 1
1: 0
2: 3
3: 10
4: 171
Right 1081528386 11:43942446-43942468 CCTTCCGGAGCCGGTTGGCGGGG 0: 1
1: 0
2: 1
3: 2
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081528366 Original CRISPR TCCGGGAGAAGCCGCGGCCC CGG (reversed) Exonic
902754513 1:18540291-18540313 TGCAGGAGATGCCTCGGCCCTGG + Intergenic
903674375 1:25055023-25055045 CCTGGGAGAAGCCGCAACCCTGG + Intergenic
904006630 1:27366474-27366496 TCCGCGCGCAGCCCCGGCCCGGG + Exonic
905446078 1:38029234-38029256 TCTGGGAGGAGCTGCTGCCCAGG - Intergenic
911052366 1:93681687-93681709 TCCGGGAGCAGCCGCGGCGCGGG - Intronic
912950689 1:114118409-114118431 CCAGGGAGAAGCCGAGGCACTGG + Intronic
915272078 1:154760624-154760646 TCGTGGAGAGGCCGGGGCCCGGG - Intronic
916561917 1:165940884-165940906 TCAGGGAGCAGCCACTGCCCAGG + Intergenic
917740828 1:177960687-177960709 TCCTGGAGATGCCCCGGCTCAGG + Intronic
920139244 1:203795886-203795908 CCCGGGATAGGCCGCGACCCAGG - Intronic
1065857223 10:29840315-29840337 TTCCAGAGAAGCCGTGGCCCAGG + Intergenic
1067558617 10:47289162-47289184 GCTGGGAGATGCAGCGGCCCTGG + Intergenic
1069988148 10:72298013-72298035 TACGGGCGCAGCCGTGGCCCTGG - Intergenic
1070552157 10:77498370-77498392 TCAGGGACAAGCCCCTGCCCTGG - Intronic
1070920535 10:80182770-80182792 TCCGGGAGAAGGCTCGGCTCTGG + Intronic
1071514898 10:86290933-86290955 TCCTGGAGAGGAAGCGGCCCAGG + Intronic
1073030284 10:100520137-100520159 AGCGGGAGAAGACCCGGCCCTGG + Intronic
1074227947 10:111505787-111505809 CCAGGGAGAAGCAGCTGCCCAGG - Intergenic
1075079154 10:119371195-119371217 GCGGGGAGAAGCTGCAGCCCGGG - Intronic
1076600009 10:131651190-131651212 TGAGGGAGAAGCCAGGGCCCTGG - Intergenic
1076746039 10:132515053-132515075 TCCAGGAGAGGCCTCGGGCCAGG - Intergenic
1076887487 10:133269360-133269382 CCAGGCAGAAGCCGCGGGCCCGG - Intronic
1077226054 11:1439611-1439633 CTCGGGAGAAGCCGCGAGCCCGG - Intronic
1079382348 11:19949089-19949111 TCTGGGAGAAAGGGCGGCCCCGG - Intronic
1080418457 11:32090940-32090962 GCCGGGGGAAGCCGGGGCCGCGG - Exonic
1081528366 11:43942403-43942425 TCCGGGAGAAGCCGCGGCCCCGG - Exonic
1083408461 11:62474938-62474960 CCCAGGAGAAGCCGCTGCACTGG + Intronic
1083795507 11:65014423-65014445 GCCGGGAGGAGCCGCACCCCAGG + Intronic
1084053690 11:66617337-66617359 ACCAGGAGAAGGCGCGCCCCCGG - Intronic
1084561824 11:69909863-69909885 TCCCGGAGCAGCCAGGGCCCTGG + Intergenic
1087141366 11:94768637-94768659 TCCGTGAGCAGCAGGGGCCCGGG - Intronic
1088457677 11:110050021-110050043 TCCGAGAGAACCAGCTGCCCAGG + Intergenic
1089268238 11:117282231-117282253 TCCTGGAGAAGCTGCTGACCCGG + Exonic
1089505276 11:118958244-118958266 TCCTGGAGAAGCTGCTGCTCCGG - Exonic
1089668725 11:120037234-120037256 CCTGGGAGAAGCAGCAGCCCCGG + Intergenic
1089966207 11:122656388-122656410 TGCGGGGGAAGACGCGGCGCGGG + Intronic
1090437347 11:126697717-126697739 CCCGGGAGAAGCTGAGTCCCCGG - Intronic
1091323534 11:134667896-134667918 TCAGGGAGAAGCACAGGCCCAGG + Intergenic
1094470336 12:30796433-30796455 TCCGGGAGGGGTCGGGGCCCCGG + Intergenic
1103620360 12:122183511-122183533 TCAGGGAGAGGCCCCAGCCCAGG - Intronic
1104987107 12:132603479-132603501 GCCGGGAGATGCTGTGGCCCCGG - Intronic
1108602225 13:52004831-52004853 TCTTGGAGAACCCGGGGCCCAGG - Intronic
1109563372 13:64078740-64078762 TCCGGGCGCAGCTGCAGCCCAGG - Intergenic
1110450798 13:75636128-75636150 TCCGCCAGGGGCCGCGGCCCGGG - Intronic
1115753523 14:36513482-36513504 TCCTGGAGACGCGGAGGCCCGGG - Exonic
1117176702 14:53153068-53153090 TCCGTGGGGACCCGCGGCCCGGG + Exonic
1117723128 14:58646425-58646447 TCAGGGAGAAAACGCGGGCCGGG + Exonic
1121089280 14:91170108-91170130 CCAGGGAGAAGCTGCAGCCCAGG - Exonic
1122271115 14:100568800-100568822 CCCGGGAGAGGCCGCTCCCCGGG + Intronic
1122977479 14:105176850-105176872 TCCAGGGGAAGCTGAGGCCCTGG - Intronic
1123012414 14:105355872-105355894 TCTGGGAGAAGGGGCAGCCCAGG + Intronic
1125536295 15:40442318-40442340 GCCGGGAGGAGCTGCGGCACTGG + Intronic
1127884816 15:63189750-63189772 TGAGGGAGGGGCCGCGGCCCGGG + Intronic
1130520580 15:84658160-84658182 CCCGAACGAAGCCGCGGCCCGGG - Exonic
1131827171 15:96331168-96331190 TCCGGCGGCAGCGGCGGCCCGGG + Exonic
1132099813 15:99015223-99015245 TCCGAGAGAAGCCGTGACCGAGG - Intergenic
1132546539 16:535872-535894 TACAGGAGCAGCAGCGGCCCAGG + Intronic
1132650554 16:1019707-1019729 GCCGGCAGCAGCCCCGGCCCTGG + Intergenic
1132838152 16:1964983-1965005 TCCGGCCCCAGCCGCGGCCCGGG + Intergenic
1132875536 16:2135430-2135452 CCCGGGAGAGGCCGCGGGACGGG - Intronic
1132889347 16:2196346-2196368 TGCTGCAGAGGCCGCGGCCCGGG - Exonic
1133802241 16:9092668-9092690 TCAGGGACGAGCCGCGGCGCAGG - Intronic
1134519451 16:14911930-14911952 CCCGGGAGAGGCCGCGGGACGGG + Intronic
1134554485 16:15154305-15154327 CCCGGGAGAGGCCGCGGGACGGG - Intergenic
1134707121 16:16310585-16310607 CCCGGGAGAGGCCGCGGGACGGG + Intergenic
1134960419 16:18401539-18401561 CCCGGGAGAGGCCGCGGGACGGG - Intergenic
1136471510 16:30483838-30483860 TCCGGGAGGAGCTGGGGGCCCGG + Exonic
1139700173 16:68703336-68703358 TCAGGGAGAAGACCCAGCCCGGG + Intronic
1139953246 16:70681852-70681874 TCCTGGAGAAACCTCAGCCCTGG + Intronic
1141407628 16:83807984-83808006 GTCGCGAGAAGCAGCGGCCCGGG + Exonic
1141582718 16:85011307-85011329 GCCGGGAGGAGCCGCAGCGCCGG - Exonic
1141634208 16:85305083-85305105 ACCAGGACAAGCTGCGGCCCAGG - Intergenic
1141639961 16:85335304-85335326 GCCGGGAGCAGCCCCGGGCCCGG + Intergenic
1142974575 17:3636016-3636038 TCCTGGAGGCGGCGCGGCCCCGG + Intronic
1144731612 17:17529321-17529343 TCCTGGAGAGGCCCTGGCCCAGG - Intronic
1147971137 17:44219570-44219592 TCCGGGCGAGGCGGCGGCGCTGG + Intronic
1148128304 17:45247937-45247959 TCAGGCGGAAGCCGGGGCCCGGG + Intergenic
1149598292 17:57876755-57876777 TCTGGGGGAAGCCTCGCCCCTGG + Intronic
1149772420 17:59332042-59332064 TCCGCGAGCGGCCGCGGGCCCGG - Intronic
1150002635 17:61451545-61451567 TCCTGGGGAAACTGCGGCCCAGG - Intergenic
1151658080 17:75504896-75504918 TCCGGGAGAAGCCTGGGCGCAGG + Exonic
1152069585 17:78128205-78128227 CCCGGGAGCAGCCGCTACCCAGG + Intronic
1152743910 17:82030666-82030688 TCCGGGAGAAGCTGCGGCTCCGG + Exonic
1152921021 17:83066745-83066767 CCAGGGTGAAGCCGTGGCCCCGG - Intergenic
1152921045 17:83066830-83066852 CCAGGGTGAAGCCGTGGCCCCGG - Intergenic
1152921090 17:83067000-83067022 CCAGGGTGAAGCCGTGGCCCCGG - Intergenic
1160454110 18:78985520-78985542 TCCTGGAAAAGCCACTGCCCTGG - Intronic
1160717814 19:584359-584381 GCCGGGAGCAGCTGCCGCCCGGG - Intergenic
1160828081 19:1089935-1089957 TCCGAGAGAACCAGCTGCCCAGG - Exonic
1160843783 19:1157766-1157788 TCCGGGAGAATCCGAGGAACCGG + Intronic
1160904541 19:1446143-1446165 TTCGGGAGGAGCCCCGCCCCGGG + Intergenic
1160966348 19:1748558-1748580 TCCCGCAGAACCGGCGGCCCTGG + Intergenic
1161089417 19:2352635-2352657 TTCAGGAGAAGCCGGGGACCAGG + Intronic
925169074 2:1740089-1740111 TCTGGGAGTACCCGCGGTCCCGG - Intronic
925404123 2:3595037-3595059 GCAGGGAGAAGCCTCGGCCCGGG - Intronic
925912899 2:8584536-8584558 TCCGAGGGAAGCCTAGGCCCGGG - Intergenic
927940951 2:27102477-27102499 TCAGGGAGAAGACCAGGCCCAGG - Intronic
928237409 2:29556141-29556163 TCTGGGAGATGCCGCAGCCTAGG + Intronic
930700700 2:54456335-54456357 TCCGGGAGGAGAGGCGGCCGAGG - Exonic
932814192 2:74848916-74848938 TCGGGGAGCAGCCTCGACCCAGG - Intronic
933168190 2:79097271-79097293 TCCGTGTGGAGCTGCGGCCCTGG + Intergenic
934933054 2:98444530-98444552 TCCTGGAGGAGCCGCGACCCGGG - Intergenic
936556801 2:113503527-113503549 TGCGGGAGAACGCGCAGCCCGGG - Intergenic
939231108 2:139427319-139427341 TCCAGGAGCAGCAGAGGCCCTGG - Intergenic
941020959 2:160407626-160407648 TCCCAGAGCTGCCGCGGCCCCGG - Intronic
941110366 2:161414608-161414630 TCCGGGAGCTGCCCCGGCCCGGG + Intergenic
942074234 2:172342228-172342250 TTCGGGAGAAGCAGAGGCCACGG + Intergenic
946418554 2:219552446-219552468 ACCGGGACAAGCCCCGCCCCTGG - Intronic
947765475 2:232634537-232634559 TCCTGGAGCAGGCGCGGCCCGGG + Intronic
948514839 2:238497510-238497532 GGCGGGAGAAGCCACAGCCCGGG + Intergenic
948767861 2:240232851-240232873 TCCGGGAGAAGCCAGGCCTCGGG - Intergenic
1171351544 20:24506730-24506752 TCCTGGAGGAGCCACTGCCCCGG - Intronic
1172702929 20:36863683-36863705 GCCGGGCGGAGCCGGGGCCCGGG - Exonic
1172808522 20:37630784-37630806 GCTGGCAGAAGCCGTGGCCCAGG + Intergenic
1174666253 20:52260683-52260705 TCCAGTAGCAGCAGCGGCCCTGG + Intergenic
1175399626 20:58693016-58693038 TCCGCGGGAAGCTGCAGCCCCGG + Exonic
1175827767 20:61945698-61945720 TCGGTGAGAAGGCGCGGCCACGG - Intergenic
1175873728 20:62220031-62220053 GCCGGGAGGGGCCCCGGCCCGGG + Exonic
1175912619 20:62412056-62412078 GCCGGCAGGAGCCTCGGCCCTGG - Intronic
1175929067 20:62485094-62485116 CCCGGGAGAGGCAGCAGCCCTGG + Intergenic
1176297340 21:5081111-5081133 CCCTGGAGGAGCCGTGGCCCTGG - Intergenic
1179681099 21:43021931-43021953 ACAGGGAGAAGACGCGGCCATGG - Intronic
1179859689 21:44180837-44180859 CCCTGGAGGAGCCGTGGCCCTGG + Intergenic
1180733810 22:18001198-18001220 GCCGGGAGCCGCCGCGGCGCGGG - Intronic
1181731435 22:24849771-24849793 CCCGGAAGAAGCGGCAGCCCAGG + Intronic
1182743366 22:32585236-32585258 TCCCAGAGAAGCAGAGGCCCAGG + Intronic
1185246288 22:49775011-49775033 TCTGGGAGGAGCTGTGGCCCCGG - Intronic
951411538 3:22372555-22372577 TCCGGGAGGAGCAGCCGCCGGGG + Intronic
958779422 3:98522983-98523005 TCCGGGCCGGGCCGCGGCCCGGG + Intronic
962697330 3:137963066-137963088 CCCTGGAGAAGCCTCGGGCCAGG + Intergenic
967862348 3:194161458-194161480 GCCGGGGGCAGCCGTGGCCCCGG - Intergenic
968433748 4:574926-574948 CCTGCGAGACGCCGCGGCCCTGG - Intergenic
968480607 4:831469-831491 TACGGGAGAAGCTGCTGCCTAGG + Intergenic
969227966 4:5811509-5811531 TCCGGAAGAAGCCCCTCCCCAGG - Exonic
978340804 4:107719974-107719996 GCCGGGAGGCGCCGCAGCCCCGG + Intronic
984589422 4:181600681-181600703 GCAGGGAGCAGCCACGGCCCTGG - Intergenic
986132160 5:4942049-4942071 TCAGGGAGAAGCCACGGGCTTGG - Intergenic
992950899 5:81857229-81857251 TCCTGGAGAACCCACAGCCCAGG + Intergenic
998094272 5:139388471-139388493 TCCGGGAGCAGCTCCGGTCCAGG + Exonic
1000305074 5:159987333-159987355 TGCTGGAGACGCCGCGGCGCCGG - Intergenic
1002994514 6:2270224-2270246 TCCAGGAGAGGCCTGGGCCCTGG + Intergenic
1003425354 6:5995104-5995126 TCCGGGAGAAGGCTCGGGGCTGG + Intergenic
1011272457 6:85593537-85593559 TCGGAGAAAAGCCGCCGCCCAGG + Intronic
1011517366 6:88167424-88167446 CTCGGCAGAAGCGGCGGCCCAGG - Intergenic
1018462866 6:164015686-164015708 TCTGGGAGAAGCCACGGACATGG - Intergenic
1019177291 6:170166581-170166603 TCCGGGAGCAGCCCCTCCCCGGG - Intergenic
1019418610 7:938567-938589 TTCGGGAGAAGACGGAGCCCGGG - Intronic
1019594011 7:1850148-1850170 TCCAGGGGAAGCCGCTGCCCCGG - Intronic
1019633817 7:2064806-2064828 CCTGGGAGAAGCCGCTGTCCTGG - Intronic
1019964897 7:4490735-4490757 TCCAGGCAAAGCCGTGGCCCAGG - Intergenic
1023913900 7:44574191-44574213 TGCAGGAGAAGCCTCGGCCGGGG + Intronic
1026000444 7:66556629-66556651 TCCTGGAGAAGCCCCCGCCCAGG + Intergenic
1026808468 7:73442976-73442998 TCAGGGAGCACCCTCGGCCCAGG + Intronic
1027230306 7:76268264-76268286 TCTGGGAGAAGCCCCAACCCAGG - Intronic
1029544095 7:101201296-101201318 TCCTGGAGATGCCCCGGACCAGG - Intergenic
1033681688 7:143601421-143601443 TCCAGGAGAATCCAGGGCCCTGG + Intergenic
1033703203 7:143860392-143860414 TCCAGGAGAATCCAGGGCCCTGG - Exonic
1035168516 7:157005458-157005480 TCCGGGAGAAGCCGCCGGCCGGG + Exonic
1035747865 8:1974407-1974429 CCCGGGAGGAGCCCCCGCCCTGG - Intronic
1036294129 8:7521659-7521681 TCAGGGAGGAGGCGCCGCCCTGG + Intergenic
1036328433 8:7799332-7799354 TCAGGGAGGAGGCGCCGCCCTGG - Intergenic
1036390243 8:8318742-8318764 CCCGGGAGAAGCAGCTGCCCCGG - Exonic
1038798330 8:30728175-30728197 TCCTGGAGAAGCCGTGCCACTGG - Intergenic
1039453789 8:37695506-37695528 TCCCGGAGAAGTCCCGTCCCAGG + Intergenic
1049468383 8:142764129-142764151 TTCAGGAGAAGCAGCTGCCCGGG + Intergenic
1053503767 9:38622354-38622376 TCCAGCAGGAGCCGCCGCCCGGG - Intergenic
1055030811 9:71769687-71769709 TCTGGGTGAGGGCGCGGCCCGGG + Intronic
1057353272 9:94317414-94317436 GCCAGGAGAAGCTGGGGCCCAGG - Intergenic
1057654479 9:96940178-96940200 GCCAGGAGAAGCTGGGGCCCAGG + Intronic
1057757301 9:97848534-97848556 TCCTGGCAAAGCCGTGGCCCGGG - Intergenic
1058851122 9:109013131-109013153 TCCGGGACGGGCCTCGGCCCGGG - Intronic
1060137750 9:121173700-121173722 TCCGGGAGAAACTGCGTCACCGG + Exonic
1060551157 9:124486039-124486061 TCCCGGTAAAGCCGAGGCCCTGG - Intronic
1060979846 9:127785772-127785794 TTCGGCAGCAGCGGCGGCCCGGG + Intronic
1061149102 9:128818847-128818869 CCCGGGGGACCCCGCGGCCCGGG + Exonic
1062116805 9:134814015-134814037 TCCGGGAGAAGGCGGCCCCCCGG + Exonic
1062303777 9:135890418-135890440 TCAGGGGGAAACCGCGGTCCAGG - Intronic
1062341534 9:136095658-136095680 TCCGGCCGAGGCCGGGGCCCGGG - Intergenic
1062382627 9:136294767-136294789 TCCTGGAGAGGCCGTGGCCATGG - Intronic
1062453438 9:136625022-136625044 TCCTGGGGAAACCGAGGCCCAGG + Intergenic
1062633763 9:137479073-137479095 TCCTGGAGAAGACGCGGCGCGGG + Exonic
1197749914 X:129957284-129957306 TCGGGGAGGAGCCGGGGCCTGGG - Intergenic
1197850145 X:130849931-130849953 TCAGGGAGAAGGAGAGGCCCAGG - Intronic
1200061266 X:153484829-153484851 TCCAGGAGAGGCCGCGGCTGAGG - Intronic
1200092498 X:153642482-153642504 TCCAGGAGAGGCCGCCACCCGGG + Intronic