ID: 1081528370

View in Genome Browser
Species Human (GRCh38)
Location 11:43942417-43942439
Sequence TCTCCCGGAACCCCCGCGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081528364_1081528370 0 Left 1081528364 11:43942394-43942416 CCGCGTGCTCCGGGGCCGCGGCT 0: 1
1: 1
2: 1
3: 22
4: 139
Right 1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1081528357_1081528370 25 Left 1081528357 11:43942369-43942391 CCTGTCCGGGCGCAGCTCGGGCC 0: 1
1: 0
2: 1
3: 6
4: 186
Right 1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1081528362_1081528370 4 Left 1081528362 11:43942390-43942412 CCAGCCGCGTGCTCCGGGGCCGC 0: 1
1: 0
2: 3
3: 20
4: 201
Right 1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1081528358_1081528370 20 Left 1081528358 11:43942374-43942396 CCGGGCGCAGCTCGGGCCAGCCG 0: 1
1: 0
2: 2
3: 18
4: 211
Right 1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1081528356_1081528370 26 Left 1081528356 11:43942368-43942390 CCCTGTCCGGGCGCAGCTCGGGC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1081528366_1081528370 -9 Left 1081528366 11:43942403-43942425 CCGGGGCCGCGGCTTCTCCCGGA 0: 1
1: 0
2: 3
3: 10
4: 171
Right 1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081528370 Original CRISPR TCTCCCGGAACCCCCGCGGG CGG Exonic
900467034 1:2830890-2830912 TCTCCCGGAGCCCCGGCGAGGGG + Intergenic
901443515 1:9293250-9293272 GCCCCCGGAGCCACCGCGGGAGG - Intronic
904190313 1:28737745-28737767 TCTCCGGGAAGCGCCCCGGGCGG + Intronic
918145708 1:181753900-181753922 TCTCTGGGAACCCACGCGGTGGG - Intronic
1064031702 10:11887045-11887067 TGTCCCGAAAGCCCCGCAGGAGG + Intergenic
1065239899 10:23694846-23694868 TCTCGAGGCTCCCCCGCGGGCGG - Intronic
1077051312 11:568277-568299 CCCCCCGCAGCCCCCGCGGGAGG + Intergenic
1077489652 11:2854990-2855012 TCTCCCAGAACAGCCGAGGGAGG + Intergenic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1081726547 11:45333826-45333848 TTTCCCGGAAGCCCTGCAGGAGG + Intergenic
1082076799 11:47981085-47981107 TTCCCCGGAACCCCCCGGGGGGG - Intronic
1091596953 12:1884740-1884762 TCTCCCTGGACACCCGTGGGAGG + Intronic
1091894619 12:4091195-4091217 TCTCTGGGAACCCCCTCTGGAGG - Intergenic
1124640374 15:31392835-31392857 CCTCCCGGAAGCGTCGCGGGCGG - Intronic
1129644858 15:77420300-77420322 TCTCCCTCAGCCCCAGCGGGAGG + Intergenic
1132329292 15:101000562-101000584 TCTCCTGGAAGCCCTGAGGGAGG + Intronic
1132645447 16:997363-997385 TCTCCCTGGGCCCCCGAGGGAGG + Intergenic
1137774519 16:51044149-51044171 GCTGCCTGAACCCCAGCGGGTGG - Intergenic
1142496555 17:309422-309444 TATCCCGGACCCCCAGCAGGGGG - Intronic
1142496575 17:309477-309499 TATCCCGGACCCCCAGCAGGGGG - Intronic
1142496600 17:309537-309559 TATCCCGGACCCCCAGCAGGGGG - Intronic
1142863493 17:2777154-2777176 TCCTCAGAAACCCCCGCGGGCGG + Intronic
1144331549 17:14228705-14228727 TAGCCCGGGACCCCAGCGGGGGG - Intergenic
1151407491 17:73898690-73898712 TGACCCTGAACCCCCGTGGGTGG - Intergenic
1152209699 17:78996508-78996530 TCTCCCTGAACCCCAGCAGGGGG - Intronic
1152282844 17:79395652-79395674 TCTCCCCCAACCCCAACGGGTGG + Intronic
1152659169 17:81534538-81534560 TCTCCCAGGACCCCTGGGGGAGG - Intronic
1160834463 19:1117997-1118019 TCTCCCGTAACCCCCAGGGCCGG - Intronic
1161620310 19:5293775-5293797 TCCCCTGGACCCCCAGCGGGAGG - Intronic
1162930562 19:13955573-13955595 ACTCCTGGAACCCCCCCAGGAGG + Intronic
1166267026 19:41690687-41690709 TCTCCAGGGACCCTCGGGGGTGG + Intronic
1167338025 19:48898483-48898505 TCTCCCGGATCCCAGGCAGGTGG - Intronic
925331551 2:3062685-3062707 TCTCCCAGAACCACCACAGGGGG + Intergenic
934853136 2:97713721-97713743 TCTCCCAGAGCCCCCTGGGGTGG - Intronic
934927540 2:98392007-98392029 TCTCCCGGAACACTCCCGTGGGG - Intronic
944461545 2:199955434-199955456 CCTCCCGGTACCCCGGCTGGAGG - Exonic
945006882 2:205417847-205417869 TCTCCGGGAACCCCCAGTGGAGG + Intronic
948259754 2:236594839-236594861 TCTTCCAGCACCCCCGCAGGTGG - Intergenic
1169327488 20:4687072-4687094 GCTCCCGGAACTCCCCCGGCGGG - Intronic
1178453782 21:32728216-32728238 TCTCCCTGCACCCCCGGCGGTGG - Intergenic
1180005585 21:45019034-45019056 CCTCCAGGACCCCGCGCGGGAGG - Intergenic
1180726578 22:17951012-17951034 TCTCCCGGAAGACCCGTGGTAGG - Intronic
1181563098 22:23717037-23717059 TCGCCCGGAAGCCCGGCGGTGGG - Intergenic
1182459136 22:30471873-30471895 TCTTCCGGAACTCCAGGGGGAGG + Intronic
960586122 3:119322870-119322892 GCACCCGGGACCCCCGCGGCCGG - Intronic
961623257 3:128241008-128241030 TGTCCTGGAACACCCGCAGGGGG + Intronic
965757374 3:172040156-172040178 CCTCCCGGAATCTCCGCGGCAGG + Intronic
966355174 3:179071921-179071943 GCTCCCGCATCCCCGGCGGGCGG + Exonic
971457920 4:26861271-26861293 TGCCCCGGCACCTCCGCGGGCGG + Exonic
982712176 4:158768865-158768887 GCTCACGTAACCCCGGCGGGAGG - Intergenic
985537581 5:473603-473625 TGTCCCGGGACCCCCGGCGGGGG - Intronic
985774202 5:1832164-1832186 CCTCCCGGAATCCCTGCGGCTGG - Intergenic
985854685 5:2415852-2415874 TCTCCCTGAATCACCGCGCGGGG + Intergenic
988856203 5:35230131-35230153 TCTCCAGGAGCCCGCGCCGGTGG + Intronic
995805801 5:116051238-116051260 TCTCCTGGAACCCCCGGCAGAGG + Intronic
1001805447 5:174581703-174581725 TCTCCCGGGATCCCCTCTGGCGG - Intergenic
1011733938 6:90295089-90295111 TCTCCCGGCGGGCCCGCGGGCGG - Intronic
1017914207 6:158819166-158819188 TCGCCCGGCACCCCCGGGGCAGG - Intronic
1024323090 7:48089036-48089058 CCTCCCGGGACCTTCGCGGGAGG + Intronic
1029496224 7:100896626-100896648 ACTTCTGGAACCCCCGCGGGTGG + Intronic
1037820768 8:22133590-22133612 TCTCCCGGGACCCGCGGGGGTGG + Intergenic
1056746960 9:89311386-89311408 TCAGCCGGGGCCCCCGCGGGCGG + Intronic
1060269690 9:122131857-122131879 TCTCCAGGAAGCCCAGCGGGTGG - Intergenic
1060406201 9:123374253-123374275 TCTCCCGGGAGCCCAGCGTGTGG + Intronic
1062234138 9:135500077-135500099 TGGCCCGGTCCCCCCGCGGGTGG - Intronic
1062341056 9:136094237-136094259 CCTCCCCCAACCCCCGCGCGGGG - Intronic
1062561951 9:137145636-137145658 ACTGCCGGAACACCCGCCGGAGG - Intronic
1188085421 X:25896515-25896537 TCTCGAGGAATCCCTGCGGGGGG - Intergenic