ID: 1081528370

View in Genome Browser
Species Human (GRCh38)
Location 11:43942417-43942439
Sequence TCTCCCGGAACCCCCGCGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081528362_1081528370 4 Left 1081528362 11:43942390-43942412 CCAGCCGCGTGCTCCGGGGCCGC 0: 1
1: 0
2: 3
3: 20
4: 201
Right 1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1081528358_1081528370 20 Left 1081528358 11:43942374-43942396 CCGGGCGCAGCTCGGGCCAGCCG 0: 1
1: 0
2: 2
3: 18
4: 211
Right 1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1081528357_1081528370 25 Left 1081528357 11:43942369-43942391 CCTGTCCGGGCGCAGCTCGGGCC 0: 1
1: 0
2: 1
3: 6
4: 186
Right 1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1081528364_1081528370 0 Left 1081528364 11:43942394-43942416 CCGCGTGCTCCGGGGCCGCGGCT 0: 1
1: 1
2: 1
3: 22
4: 139
Right 1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1081528356_1081528370 26 Left 1081528356 11:43942368-43942390 CCCTGTCCGGGCGCAGCTCGGGC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1081528366_1081528370 -9 Left 1081528366 11:43942403-43942425 CCGGGGCCGCGGCTTCTCCCGGA 0: 1
1: 0
2: 3
3: 10
4: 171
Right 1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081528370 Original CRISPR TCTCCCGGAACCCCCGCGGG CGG Exonic