ID: 1081528523

View in Genome Browser
Species Human (GRCh38)
Location 11:43942879-43942901
Sequence GCCTCCGGCGTCTGCGGGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081528523_1081528529 -3 Left 1081528523 11:43942879-43942901 CCGGCCCCGCAGACGCCGGAGGC 0: 1
1: 0
2: 3
3: 16
4: 202
Right 1081528529 11:43942899-43942921 GGCGCCATGGCCGCCAAGCCCGG 0: 1
1: 0
2: 2
3: 16
4: 194
1081528523_1081528532 8 Left 1081528523 11:43942879-43942901 CCGGCCCCGCAGACGCCGGAGGC 0: 1
1: 0
2: 3
3: 16
4: 202
Right 1081528532 11:43942910-43942932 CGCCAAGCCCGGCGAGCTGATGG 0: 1
1: 1
2: 0
3: 5
4: 73
1081528523_1081528533 9 Left 1081528523 11:43942879-43942901 CCGGCCCCGCAGACGCCGGAGGC 0: 1
1: 0
2: 3
3: 16
4: 202
Right 1081528533 11:43942911-43942933 GCCAAGCCCGGCGAGCTGATGGG 0: 1
1: 0
2: 1
3: 4
4: 56
1081528523_1081528537 29 Left 1081528523 11:43942879-43942901 CCGGCCCCGCAGACGCCGGAGGC 0: 1
1: 0
2: 3
3: 16
4: 202
Right 1081528537 11:43942931-43942953 GGGCATCTGCTCCAGTTACCAGG 0: 1
1: 0
2: 0
3: 12
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081528523 Original CRISPR GCCTCCGGCGTCTGCGGGGC CGG (reversed) Exonic
900350499 1:2232273-2232295 GCCTTCGGGCTCTGCGGAGCCGG + Intronic
900513583 1:3071162-3071184 GGCCCCGGCGTCAGCGCGGCCGG - Intronic
901047354 1:6405220-6405242 GGCTCCGGCCTCTGCTGGGTGGG - Intergenic
901673043 1:10867106-10867128 GCCTCGAGCGGCTGCGGGGGCGG - Intergenic
901805492 1:11736166-11736188 GCCCCCCGCGGCTGCGGCGCAGG + Exonic
902350207 1:15848317-15848339 GCCTCGGGTGTCGGCGGTGCGGG + Intronic
903579205 1:24358315-24358337 GCCACTGGAGTCTGTGGGGCTGG + Exonic
904725295 1:32542324-32542346 GCCTCGGGGGTCGGGGGGGCGGG + Intronic
906116090 1:43358469-43358491 GCCGCGGGCGGCAGCGGGGCAGG - Intergenic
914511388 1:148335281-148335303 GCCTCAGGCTTCTGCGTAGCTGG + Intergenic
914919963 1:151839808-151839830 GCATCCCGCGTCTGCAGGGCGGG + Intronic
915168594 1:153962634-153962656 GCCTCCAGTGCCTGTGGGGCTGG - Exonic
916108495 1:161447411-161447433 GCCGCCGGCGTCGCGGGGGCTGG - Intergenic
916110083 1:161454792-161454814 GCCGCCGGCGTCGCGGGGGCTGG - Intergenic
916111668 1:161462202-161462224 GCCGCCGGCGTCGCGGGGGCTGG - Intergenic
916113255 1:161469583-161469605 GCCGCCGGCGTCGCGGGGGCTGG - Intergenic
916656031 1:166876071-166876093 GACGCGGGCGTCTCCGGGGCGGG + Intronic
917429275 1:174948766-174948788 GCCTCAGGCTTCTGCTGGGATGG - Intronic
919451231 1:197775238-197775260 GCCGCCGGCGTGGGCGGGGACGG - Exonic
1066402618 10:35090368-35090390 ACCCCCCGCGTCTCCGGGGCCGG - Intronic
1069741848 10:70689854-70689876 GCCTGAGGGGTCTGAGGGGCAGG - Intronic
1069871072 10:71533446-71533468 ACCACAGGCTTCTGCGGGGCAGG - Intronic
1073403528 10:103277415-103277437 GCCGCCGGCGTCCGACGGGCTGG + Exonic
1073812289 10:107164423-107164445 GCCCCGGGCGTCTGCGGCGGCGG - Exonic
1074843141 10:117374947-117374969 GTCTCCCGCGTCGGCGGGGCGGG + Exonic
1076874089 10:133207541-133207563 GCCTCCGCCGCCTGTGGGCCTGG + Intronic
1077281432 11:1747941-1747963 GCCGCCGGAGCCTGCAGGGCAGG + Exonic
1077285604 11:1763978-1764000 GCGGCCGGCGTGCGCGGGGCGGG + Exonic
1077674936 11:4187352-4187374 GCCTCCGCTGACAGCGGGGCAGG + Intergenic
1081528523 11:43942879-43942901 GCCTCCGGCGTCTGCGGGGCCGG - Exonic
1082784948 11:57311616-57311638 GCCTCTGGGGGCTGCGGGGCGGG - Intronic
1083732791 11:64661876-64661898 GGCTCCAGGGCCTGCGGGGCAGG + Intronic
1083939504 11:65888159-65888181 GCCTCTGGCGTCGGCGGGGCGGG - Intronic
1087076220 11:94129099-94129121 GCCTCCGCCGCCGGCGGGGCGGG - Exonic
1089584547 11:119502216-119502238 GGCTCCGGCGTCTGAAGGCCCGG - Intergenic
1090962621 11:131570706-131570728 GCCTCAGGCTCCTGCGTGGCTGG - Intronic
1091550370 12:1531198-1531220 GGCTCCGGGGTCGGCGGCGCAGG + Intronic
1091791324 12:3273777-3273799 CCCTCCTGCCTGTGCGGGGCAGG + Intronic
1101340919 12:103841286-103841308 CCCTCCCGCCGCTGCGGGGCGGG + Intergenic
1102662098 12:114538216-114538238 GCCTCAGCCTTCTGAGGGGCTGG + Intergenic
1103592840 12:122004445-122004467 GGCCCCGGCCTCTGCTGGGCGGG - Intergenic
1106422466 13:29595385-29595407 GCCCCCTGCGTTGGCGGGGCCGG + Intronic
1106602459 13:31199867-31199889 GCTTCCAGCGTCTGCCGGGCTGG - Intergenic
1113728984 13:112626177-112626199 GCCTCCTGCGGCTGCTGGGGAGG + Intergenic
1113839158 13:113348801-113348823 GGTCGCGGCGTCTGCGGGGCGGG - Intronic
1113847671 13:113401837-113401859 GCCACTGGCGTCTGCCGGGATGG + Intergenic
1120632272 14:86905511-86905533 GCCCACGGCGTCGTCGGGGCGGG + Intergenic
1121117207 14:91352146-91352168 GCCACCGCCGTCTGCGGAGGAGG - Intronic
1122122882 14:99563868-99563890 GCCTCCAGGGTATGTGGGGCAGG + Intronic
1122694371 14:103545636-103545658 GCCACCGGCTCCTGAGGGGCCGG + Intergenic
1122992093 14:105241264-105241286 CCCTCGGGCCTCTGCGGAGCAGG - Exonic
1123783145 15:23646127-23646149 GCCGCCTGCACCTGCGGGGCCGG + Exonic
1126626067 15:50686771-50686793 GCCTCCGCCGGCGACGGGGCTGG + Exonic
1126800908 15:52295696-52295718 GCGCCCGGCCTCTGCGGCGCAGG - Exonic
1127267958 15:57376442-57376464 GCGGGCGGCGACTGCGGGGCGGG + Intronic
1127911733 15:63421865-63421887 GCCTCAGGCTCCTGAGGGGCAGG - Intergenic
1132573693 16:655336-655358 GGCTCTGGCGGCTGCGTGGCGGG + Exonic
1132729631 16:1355054-1355076 GTCTGCCGCGTCTGCGGGGTCGG + Intronic
1132729639 16:1355086-1355108 GTCTCCCGCGTCTGCGGGGTCGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132729658 16:1355150-1355172 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1133123401 16:3626984-3627006 GCCTCCGTCTTCTGAGGAGCTGG + Intronic
1134656194 16:15949862-15949884 GCCCCGGGCGGCTGCGGGCCCGG - Intronic
1135430069 16:22374971-22374993 GACTCCGGCCTCTGAGAGGCGGG + Intronic
1138426050 16:56932544-56932566 GGCGCCCGCGTCGGCGGGGCAGG - Intronic
1138507976 16:57487602-57487624 GGCCCAGGCGTCTCCGGGGCAGG - Intergenic
1138651406 16:58463529-58463551 GCTTCCGCCTTCTGCGCGGCTGG - Intronic
1139482335 16:67237372-67237394 GCCGCCAGCGTCTGGAGGGCGGG + Exonic
1139548474 16:67660769-67660791 GCCCCCGGAGTCTGGGGAGCAGG - Exonic
1142471629 17:166294-166316 GCCTCCACCTTCTGTGGGGCTGG + Intronic
1142508050 17:378212-378234 GCCTCCCGGGTCTGTGGTGCCGG - Intronic
1142513115 17:410405-410427 GCCTCGGGCGCCCCCGGGGCGGG + Exonic
1145225816 17:21127186-21127208 GGCTCCGGCGAGTGCGTGGCGGG + Intronic
1146352879 17:32110822-32110844 ACCTCAGGCGTGTGCGGGGCGGG - Intergenic
1147015690 17:37489883-37489905 GCCACCGGCTTCTGCGGGCTGGG - Exonic
1147429487 17:40362852-40362874 GCTTCCGGCTTCTGCGGTGCGGG + Intronic
1148208624 17:45794868-45794890 GCCTCCTGCCTCTGAGGTGCCGG + Intronic
1148561805 17:48610689-48610711 GCGGCCGGCGTCTACGCGGCCGG - Exonic
1148847998 17:50540462-50540484 GCCTCCGCCGCCTGTGGGACAGG + Intronic
1151755662 17:76074199-76074221 GCCTCGGCCTTCTGAGGGGCTGG - Intronic
1152406578 17:80101476-80101498 GCCTCGGGCGCCTGCGCGGGAGG + Intergenic
1152468038 17:80476659-80476681 GCCGCCGACGTCAGCGGGGGAGG + Intronic
1152794287 17:82299259-82299281 GCCTTCTGCGACTGTGGGGCTGG + Intergenic
1152848152 17:82615181-82615203 ACCTCAGGCGTGTGCGGGGCGGG - Exonic
1152917976 17:83051809-83051831 GCCTACGGCGCCTGCGCGGGCGG + Exonic
1154367628 18:13726136-13726158 GCCGCCGGGGTCTGTGGGGTCGG + Intronic
1161721481 19:5904903-5904925 GCCTCCCGGATCTGCAGGGCCGG - Exonic
1162124217 19:8490561-8490583 ACCTCCCGGGGCTGCGGGGCCGG + Intronic
1162651567 19:12092566-12092588 GACTCCGGGGTCTGTGGGGCTGG + Intronic
1162706035 19:12555520-12555542 GGCCCCGGTGTCTGCGGGGCAGG - Intronic
1163063525 19:14776621-14776643 GCCGCTGGTGTCTGTGGGGCCGG - Intronic
1163701463 19:18788750-18788772 ACCTCCGGCGGCTCCGGCGCAGG - Exonic
1167297941 19:48662798-48662820 GCCAGCTGGGTCTGCGGGGCAGG + Intronic
1167489205 19:49782121-49782143 GACTCCTGGGTCTGCGGGGGAGG + Intronic
1167638463 19:50668013-50668035 GGCTACGGCGGCTACGGGGCCGG - Exonic
1168347771 19:55659262-55659284 GGCTCCGGCGTTTGCGGTCCCGG - Exonic
1168354880 19:55694857-55694879 GACTCCGGCGTCTTCCGGGTGGG - Exonic
925293564 2:2763774-2763796 GTCTTAGGCGTCTGTGGGGCTGG - Intergenic
926901243 2:17753876-17753898 GCCGCCGGAGTCTGAGAGGCCGG + Exonic
927692278 2:25216381-25216403 TTCTCCTGAGTCTGCGGGGCGGG + Intergenic
931304677 2:61017157-61017179 GGCTCCGGCGTCTGGGGAGAAGG - Intronic
932773604 2:74514689-74514711 GCCTCAGGGGCCCGCGGGGCTGG - Exonic
947566722 2:231198824-231198846 GCATCCGGCGGCGGCGGAGCGGG - Intronic
948116142 2:235495147-235495169 CCCCCAGGCGTCTGCTGGGCCGG - Intronic
1168830228 20:841606-841628 GCCTCCAGAGGCCGCGGGGCAGG - Intronic
1169065912 20:2693940-2693962 GCCTCCTGAGGCTGTGGGGCGGG + Intronic
1169171715 20:3470887-3470909 GTCTCCGGCGTCCGCGGCGCCGG - Intergenic
1169327545 20:4687249-4687271 GCCTCGGGCCTCGGCGGGGGCGG + Intronic
1170821393 20:19758295-19758317 GCCTCCGGGACCTGCGGGGAGGG + Intergenic
1173243490 20:41317807-41317829 GCCTCTGGCGGCCGCGGGGCGGG + Intergenic
1173843563 20:46174450-46174472 GGCCCCGGCGTGTGCTGGGCGGG + Exonic
1174542195 20:51298335-51298357 ACCTCCAGCTTGTGCGGGGCTGG - Intergenic
1174568127 20:51481604-51481626 GTCTGTGGCGTCTGCGGGGGTGG + Intronic
1174648674 20:52106156-52106178 GCCTCCGTCACCTGCTGGGCGGG - Intronic
1175074056 20:56358962-56358984 GCCTCCCGGGTCAGCGGCGCGGG + Exonic
1175569700 20:60009550-60009572 CCCTCCTCCCTCTGCGGGGCAGG + Intronic
1175653715 20:60750804-60750826 GCCTTTGGAGTCTGCAGGGCTGG + Intergenic
1175715684 20:61253002-61253024 GCGCCCGGCGGCTGCGGGCCAGG + Intronic
1175911403 20:62407011-62407033 GGCTCCGGCGGCGGCGGCGCTGG + Exonic
1176162068 20:63653152-63653174 GTCTGCGGCGCCGGCGGGGCTGG - Intronic
1176547606 21:8208429-8208451 GCCTGCGGCGCGTGCGGGGGAGG + Intergenic
1176549291 21:8214481-8214503 GGCTCCGGCGGGTGCGGGGGTGG + Intergenic
1176557184 21:8258704-8258726 GGCTCCGGCGGGTGCGGGGGTGG + Intergenic
1176566557 21:8391476-8391498 GCCTGCGGCGCGTGCGGGGGAGG + Intergenic
1176568223 21:8397519-8397541 GGCTCCGGCGGGTGCGGGGGTGG + Intergenic
1176574433 21:8435663-8435685 GCCTGCGGCGCGTGCGGGGGAGG + Intergenic
1176576126 21:8441739-8441761 GGCTCCGGCGGGTGCGGGGGTGG + Intergenic
1176611045 21:8986955-8986977 GCCTGCGGCGCGTGCGGGGGAGG + Intergenic
1179054086 21:37915771-37915793 GCCTGCGGCGACGGCGGAGCTGG + Intronic
1179243798 21:39612981-39613003 GCCCCCTGCGTCCGCGGGCCGGG + Intronic
1179977030 21:44874023-44874045 GGCTCCTGCGCCTGCGCGGCGGG + Intergenic
1180091139 21:45534362-45534384 GCCTCCTGTGTCTGGGGGTCGGG - Intronic
1180951929 22:19724364-19724386 GCCTGCGGAGGCTGCGGGCCCGG + Exonic
1180960837 22:19761560-19761582 GCGTCCTGGGGCTGCGGGGCGGG - Intronic
1180995300 22:19962515-19962537 GCCTCCGGCATCTGCAGGGCGGG - Exonic
1181432174 22:22888238-22888260 GCCTGCGGAGCCTGTGGGGCAGG + Exonic
1182519885 22:30879201-30879223 CCCTCCGGGGCCTGTGGGGCAGG + Intronic
1183264468 22:36816857-36816879 GGATCCGCCGGCTGCGGGGCCGG + Intronic
1183391095 22:37546092-37546114 GCCTCCGGCCCCAGCGGGACGGG + Intergenic
1183710865 22:39502460-39502482 GCCGCCGGCGGCTGGGCGGCGGG + Intronic
1183743440 22:39680417-39680439 GCCTCAGGTGGCTGCAGGGCAGG + Intronic
1183961377 22:41413746-41413768 GCCTCCGGCGTCCGCCGGGTGGG - Intergenic
1184037811 22:41926741-41926763 GGCCCCGGAGCCTGCGGGGCAGG - Exonic
1184086767 22:42270310-42270332 GCCTCCCGGGCCTGAGGGGCAGG - Intronic
1203252479 22_KI270733v1_random:124714-124736 GCCTGCGGCGCGTGCGGGGGAGG + Intergenic
1203254176 22_KI270733v1_random:130797-130819 GGCTCCGGCGGGTGCGGGGGTGG + Intergenic
1203260536 22_KI270733v1_random:169800-169822 GCCTGCGGCGCGTGCGGGGGAGG + Intergenic
1203262232 22_KI270733v1_random:175876-175898 GGCTCCGGCGGGTGCGGGGGTGG + Intergenic
951217766 3:20040599-20040621 GCCCCCGGCGGCAGCGGCGCAGG - Exonic
952240986 3:31531942-31531964 GCCTCCGGCTTCTGCGGCCGCGG - Intergenic
952744453 3:36764226-36764248 GGCGGCGGCGGCTGCGGGGCTGG + Intergenic
954401078 3:50320102-50320124 GACACAGGAGTCTGCGGGGCTGG - Exonic
954735754 3:52705626-52705648 GGCTCCGGGGCCTGCGGCGCGGG - Exonic
957048828 3:75396321-75396343 GCCCCCGGGGTCCGCGCGGCTGG + Intergenic
960115083 3:113885265-113885287 GCCTCCGGGGCCGGCGGTGCCGG + Intronic
962606186 3:137034792-137034814 GCCTCAGGCTTCTGAGTGGCTGG + Intergenic
966362834 3:179148537-179148559 GCCGCCGCCGCCCGCGGGGCTGG + Exonic
966883448 3:184362170-184362192 GCCTGCGGGGTGTGCGGGGGTGG + Intronic
968104425 3:195990644-195990666 GCCTCCGGCCTCTAGGGAGCGGG + Intergenic
968434109 4:576195-576217 GGCTCCGGCGGCGGCGGCGCGGG - Intergenic
968701883 4:2061313-2061335 GCCTCCGGTGTCAGCGGGGCTGG + Intronic
968850538 4:3074790-3074812 GCCTCCGGGGACTGCCGTGCCGG + Exonic
968958708 4:3731903-3731925 GCCTCCAGCGTCTGCTTTGCTGG + Intergenic
969533180 4:7740665-7740687 GGCCCCGGCCTCTGCGGGGAAGG - Exonic
974025875 4:56732744-56732766 GCCTCCGCCTTCTGAGGAGCTGG + Intergenic
979278194 4:118836198-118836220 GCCACCGGCCGCCGCGGGGCGGG + Intronic
983323692 4:166227093-166227115 GCCTCCTGAGTTGGCGGGGCAGG + Intergenic
984462911 4:180058794-180058816 TCCTCCCCGGTCTGCGGGGCCGG - Intergenic
985545588 5:507618-507640 GATTCGGGCGTCTGTGGGGCAGG - Intronic
985545608 5:507685-507707 GATTCGGGCGTCTGCGGGGTGGG - Intronic
992056593 5:72996869-72996891 GCCCCCGGGGCCGGCGGGGCCGG + Intronic
996342521 5:122454457-122454479 GCTTCCGGCCTCACCGGGGCAGG + Intronic
997869980 5:137498548-137498570 ATCGCCGGCATCTGCGGGGCAGG + Exonic
1002108251 5:176890996-176891018 GCCTCTGGGGTCTGGGGGCCTGG - Intronic
1002296260 5:178232841-178232863 GCCGCAGGGGCCTGCGGGGCGGG - Intergenic
1006296075 6:33170689-33170711 GCCTGCGGAGTCTGAGGGGAGGG - Intronic
1007389955 6:41545423-41545445 GTTTCCGGCGTGTGTGGGGCGGG + Intergenic
1008673534 6:53795973-53795995 GCCTGCGGTGGCTGCGGGGGTGG + Intronic
1012223370 6:96678021-96678043 GCCTCAGGACTCTGCAGGGCTGG + Intergenic
1015853779 6:137602502-137602524 GCCTCCAGGGTATGGGGGGCGGG + Intergenic
1017842412 6:158232407-158232429 GGCCCCGGGGTCTGCGCGGCGGG + Intronic
1019473490 7:1233249-1233271 GCCTGCGGGGTCGGCGGGGACGG + Exonic
1019639678 7:2096798-2096820 GCCCCCAGCCTCTGCTGGGCGGG - Intronic
1019927526 7:4203112-4203134 GCCTCCTGCCTCTGCGGGAAGGG - Intronic
1019980042 7:4614700-4614722 GCCTCGGGCTTCTGAGTGGCTGG + Intergenic
1022233247 7:28435482-28435504 GCCTCTAGCTTCTGCTGGGCCGG + Intronic
1026360876 7:69599753-69599775 GCGGCCGGCGGCGGCGGGGCTGG + Exonic
1026794706 7:73359050-73359072 GCCTCAGGCCTGTGTGGGGCAGG - Intergenic
1027221889 7:76219481-76219503 CCCTCAGGCTTCTGCTGGGCTGG - Intronic
1029276553 7:99408552-99408574 GGCTCCGGCGGCTGCGGCGGCGG + Exonic
1035373832 7:158395161-158395183 GCCTCCGGAGTCTGGGGTGGAGG + Intronic
1039843477 8:41309444-41309466 GACTCCGGAGGCTGCAGGGCTGG + Exonic
1045098771 8:98825457-98825479 GGCGCCGGCGGCCGCGGGGCGGG - Intronic
1047100160 8:121667531-121667553 GCCCCCGGCGGGGGCGGGGCGGG + Intergenic
1049166385 8:141128581-141128603 GCGAGCGCCGTCTGCGGGGCGGG - Intronic
1049621162 8:143598874-143598896 GCCGCCCGCTGCTGCGGGGCTGG + Exonic
1051661413 9:19430496-19430518 GACTCTGGGGTCTGCTGGGCTGG + Intronic
1053715593 9:40884734-40884756 GCCCCCGGGGTCTGCGCGGCTGG + Intergenic
1055090875 9:72364421-72364443 GCGTGCCGCCTCTGCGGGGCCGG - Intronic
1055321669 9:75088484-75088506 TGCTCCGGCGGCCGCGGGGCGGG + Intergenic
1056551680 9:87658170-87658192 GCCTCTGGCGCCTCCAGGGCAGG + Intronic
1058070819 9:100598955-100598977 GGCGCCGAGGTCTGCGGGGCGGG + Intergenic
1060599516 9:124868893-124868915 GCCCCTGGCCTCAGCGGGGCCGG - Exonic
1061727758 9:132590583-132590605 GCCTCGGTCGGCTGCGGGCCGGG + Intergenic
1061860702 9:133467343-133467365 GGCTGCGGGGTCTGCGGGGTCGG - Intronic
1061996085 9:134186841-134186863 TCCTTTGGCGTCTGAGGGGCTGG + Intergenic
1062008089 9:134251563-134251585 GCCTCCAGCGGCCCCGGGGCCGG - Intergenic
1062088839 9:134663406-134663428 GCCTCGGGAGTCTGCTGGGGAGG + Intronic
1062414117 9:136439361-136439383 CCTTCCGGCGGCTGCGGGGCCGG + Exonic
1062568322 9:137173028-137173050 GCCTCCGTTGGCTGTGGGGCAGG - Intergenic
1062684444 9:137803031-137803053 GCCCCCGGAGACTGCGTGGCGGG + Intronic
1203772860 EBV:58219-58241 GTCTCCGGCCTCTGCGGCCCCGG - Intergenic
1203468884 Un_GL000220v1:107865-107887 GCCTGCGGCGCGTGCGGGGGAGG + Intergenic
1203470577 Un_GL000220v1:113941-113963 GGCTCCGGCGGGTGCGGGGGTGG + Intergenic
1203476705 Un_GL000220v1:151837-151859 GCCTGCGGCGCGTGCGGGGGAGG + Intergenic
1203478398 Un_GL000220v1:157913-157935 GGCTCCGGCGGGTGCGGGGGTGG + Intergenic
1189322566 X:40095747-40095769 GCCGCCGGCGTCTGGAGGGTGGG - Intronic
1189821584 X:44873789-44873811 GTCTCTGGCGGCGGCGGGGCGGG + Intronic
1190344233 X:49322463-49322485 GCCTCCGGCGGGGGCGAGGCGGG + Intronic
1196779534 X:119370989-119371011 GCCTCAGGCTTCTGAGGAGCTGG + Intergenic
1199771180 X:150976240-150976262 GCCTCCGGGGTCTGGTGGGGAGG + Intergenic