ID: 1081531465

View in Genome Browser
Species Human (GRCh38)
Location 11:43962831-43962853
Sequence TGGTGACGCTAAGCAGTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081531465_1081531470 25 Left 1081531465 11:43962831-43962853 CCTGTAACTGCTTAGCGTCACCA No data
Right 1081531470 11:43962879-43962901 TCTGACACCCACTTCAGATGAGG No data
1081531465_1081531466 -9 Left 1081531465 11:43962831-43962853 CCTGTAACTGCTTAGCGTCACCA No data
Right 1081531466 11:43962845-43962867 GCGTCACCAGATAGCCCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081531465 Original CRISPR TGGTGACGCTAAGCAGTTAC AGG (reversed) Intergenic
No off target data available for this crispr