ID: 1081531467

View in Genome Browser
Species Human (GRCh38)
Location 11:43962851-43962873
Sequence CATCTTCCTTGAGGGCTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081531467_1081531474 19 Left 1081531467 11:43962851-43962873 CCAGATAGCCCTCAAGGAAGATG No data
Right 1081531474 11:43962893-43962915 CAGATGAGGATAATAGACAAGGG No data
1081531467_1081531470 5 Left 1081531467 11:43962851-43962873 CCAGATAGCCCTCAAGGAAGATG No data
Right 1081531470 11:43962879-43962901 TCTGACACCCACTTCAGATGAGG No data
1081531467_1081531473 18 Left 1081531467 11:43962851-43962873 CCAGATAGCCCTCAAGGAAGATG No data
Right 1081531473 11:43962892-43962914 TCAGATGAGGATAATAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081531467 Original CRISPR CATCTTCCTTGAGGGCTATC TGG (reversed) Intergenic
No off target data available for this crispr