ID: 1081531469

View in Genome Browser
Species Human (GRCh38)
Location 11:43962860-43962882
Sequence CAGAAAATGCATCTTCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081531469_1081531476 27 Left 1081531469 11:43962860-43962882 CCTCAAGGAAGATGCATTTTCTG No data
Right 1081531476 11:43962910-43962932 CAAGGGAGAATTATCCTGGCAGG No data
1081531469_1081531470 -4 Left 1081531469 11:43962860-43962882 CCTCAAGGAAGATGCATTTTCTG No data
Right 1081531470 11:43962879-43962901 TCTGACACCCACTTCAGATGAGG No data
1081531469_1081531474 10 Left 1081531469 11:43962860-43962882 CCTCAAGGAAGATGCATTTTCTG No data
Right 1081531474 11:43962893-43962915 CAGATGAGGATAATAGACAAGGG No data
1081531469_1081531475 23 Left 1081531469 11:43962860-43962882 CCTCAAGGAAGATGCATTTTCTG No data
Right 1081531475 11:43962906-43962928 TAGACAAGGGAGAATTATCCTGG No data
1081531469_1081531473 9 Left 1081531469 11:43962860-43962882 CCTCAAGGAAGATGCATTTTCTG No data
Right 1081531473 11:43962892-43962914 TCAGATGAGGATAATAGACAAGG No data
1081531469_1081531478 29 Left 1081531469 11:43962860-43962882 CCTCAAGGAAGATGCATTTTCTG No data
Right 1081531478 11:43962912-43962934 AGGGAGAATTATCCTGGCAGGGG No data
1081531469_1081531477 28 Left 1081531469 11:43962860-43962882 CCTCAAGGAAGATGCATTTTCTG No data
Right 1081531477 11:43962911-43962933 AAGGGAGAATTATCCTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081531469 Original CRISPR CAGAAAATGCATCTTCCTTG AGG (reversed) Intergenic