ID: 1081531470

View in Genome Browser
Species Human (GRCh38)
Location 11:43962879-43962901
Sequence TCTGACACCCACTTCAGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081531465_1081531470 25 Left 1081531465 11:43962831-43962853 CCTGTAACTGCTTAGCGTCACCA No data
Right 1081531470 11:43962879-43962901 TCTGACACCCACTTCAGATGAGG No data
1081531467_1081531470 5 Left 1081531467 11:43962851-43962873 CCAGATAGCCCTCAAGGAAGATG No data
Right 1081531470 11:43962879-43962901 TCTGACACCCACTTCAGATGAGG No data
1081531468_1081531470 -3 Left 1081531468 11:43962859-43962881 CCCTCAAGGAAGATGCATTTTCT No data
Right 1081531470 11:43962879-43962901 TCTGACACCCACTTCAGATGAGG No data
1081531469_1081531470 -4 Left 1081531469 11:43962860-43962882 CCTCAAGGAAGATGCATTTTCTG No data
Right 1081531470 11:43962879-43962901 TCTGACACCCACTTCAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081531470 Original CRISPR TCTGACACCCACTTCAGATG AGG Intergenic
No off target data available for this crispr