ID: 1081534557

View in Genome Browser
Species Human (GRCh38)
Location 11:43987549-43987571
Sequence GTCTGGGAATGGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081534553_1081534557 -8 Left 1081534553 11:43987534-43987556 CCAGCTGCAGCTGCTGTCTGGGA No data
Right 1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG No data
1081534549_1081534557 13 Left 1081534549 11:43987513-43987535 CCTTTGGCCTGTGGTCAGTGTCC No data
Right 1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG No data
1081534550_1081534557 6 Left 1081534550 11:43987520-43987542 CCTGTGGTCAGTGTCCAGCTGCA No data
Right 1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081534557 Original CRISPR GTCTGGGAATGGAGGGAAGC AGG Intergenic
No off target data available for this crispr