ID: 1081534845

View in Genome Browser
Species Human (GRCh38)
Location 11:43989184-43989206
Sequence TCTGCCGCTCATCAGCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081534837_1081534845 23 Left 1081534837 11:43989138-43989160 CCAGGCCTCAAGCTGCTGTGTGG No data
Right 1081534845 11:43989184-43989206 TCTGCCGCTCATCAGCTGTGTGG No data
1081534841_1081534845 18 Left 1081534841 11:43989143-43989165 CCTCAAGCTGCTGTGTGGGGAGG No data
Right 1081534845 11:43989184-43989206 TCTGCCGCTCATCAGCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081534845 Original CRISPR TCTGCCGCTCATCAGCTGTG TGG Intergenic
No off target data available for this crispr