ID: 1081535089

View in Genome Browser
Species Human (GRCh38)
Location 11:43990482-43990504
Sequence TGAGGGTTCCACTTCATGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081535089_1081535100 25 Left 1081535089 11:43990482-43990504 CCATTCATGAAGTGGAACCCTCA No data
Right 1081535100 11:43990530-43990552 TCCTCTTAATACTATCACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081535089 Original CRISPR TGAGGGTTCCACTTCATGAA TGG (reversed) Intergenic
No off target data available for this crispr