ID: 1081536086

View in Genome Browser
Species Human (GRCh38)
Location 11:43997209-43997231
Sequence GGCGTGGACCAACATGTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081536083_1081536086 -1 Left 1081536083 11:43997187-43997209 CCAATTAAATTAGAATCTCGGAG No data
Right 1081536086 11:43997209-43997231 GGCGTGGACCAACATGTAGCAGG No data
1081536080_1081536086 5 Left 1081536080 11:43997181-43997203 CCCAGACCAATTAAATTAGAATC 0: 5
1: 71
2: 260
3: 668
4: 1586
Right 1081536086 11:43997209-43997231 GGCGTGGACCAACATGTAGCAGG No data
1081536081_1081536086 4 Left 1081536081 11:43997182-43997204 CCAGACCAATTAAATTAGAATCT 0: 3
1: 70
2: 235
3: 690
4: 1644
Right 1081536086 11:43997209-43997231 GGCGTGGACCAACATGTAGCAGG No data
1081536078_1081536086 16 Left 1081536078 11:43997170-43997192 CCAGGGGGTTCCCCAGACCAATT No data
Right 1081536086 11:43997209-43997231 GGCGTGGACCAACATGTAGCAGG No data
1081536076_1081536086 24 Left 1081536076 11:43997162-43997184 CCCAATGTCCAGGGGGTTCCCCA No data
Right 1081536086 11:43997209-43997231 GGCGTGGACCAACATGTAGCAGG No data
1081536079_1081536086 6 Left 1081536079 11:43997180-43997202 CCCCAGACCAATTAAATTAGAAT 0: 4
1: 44
2: 243
3: 838
4: 4596
Right 1081536086 11:43997209-43997231 GGCGTGGACCAACATGTAGCAGG No data
1081536077_1081536086 23 Left 1081536077 11:43997163-43997185 CCAATGTCCAGGGGGTTCCCCAG No data
Right 1081536086 11:43997209-43997231 GGCGTGGACCAACATGTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081536086 Original CRISPR GGCGTGGACCAACATGTAGC AGG Intergenic
No off target data available for this crispr