ID: 1081536579

View in Genome Browser
Species Human (GRCh38)
Location 11:44001154-44001176
Sequence CGGAAGCCTGCAGTCTTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081536571_1081536579 30 Left 1081536571 11:44001101-44001123 CCTGTCCTAACTATGGGAGTCAC No data
Right 1081536579 11:44001154-44001176 CGGAAGCCTGCAGTCTTGTGGGG No data
1081536572_1081536579 25 Left 1081536572 11:44001106-44001128 CCTAACTATGGGAGTCACAGAGA No data
Right 1081536579 11:44001154-44001176 CGGAAGCCTGCAGTCTTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081536579 Original CRISPR CGGAAGCCTGCAGTCTTGTG GGG Intergenic
No off target data available for this crispr