ID: 1081536726

View in Genome Browser
Species Human (GRCh38)
Location 11:44002122-44002144
Sequence TGGCTCAGGAGCAGGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081536726_1081536734 14 Left 1081536726 11:44002122-44002144 CCTTTGTCCCTGCTCCTGAGCCA No data
Right 1081536734 11:44002159-44002181 CTCCTTCCTCCTGTGTTACGTGG No data
1081536726_1081536738 28 Left 1081536726 11:44002122-44002144 CCTTTGTCCCTGCTCCTGAGCCA No data
Right 1081536738 11:44002173-44002195 GTTACGTGGCCCCAGACCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081536726 Original CRISPR TGGCTCAGGAGCAGGGACAA AGG (reversed) Intergenic