ID: 1081536729

View in Genome Browser
Species Human (GRCh38)
Location 11:44002130-44002152
Sequence TTTCACCTTGGCTCAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081536729_1081536738 20 Left 1081536729 11:44002130-44002152 CCTGCTCCTGAGCCAAGGTGAAA No data
Right 1081536738 11:44002173-44002195 GTTACGTGGCCCCAGACCACCGG No data
1081536729_1081536740 26 Left 1081536729 11:44002130-44002152 CCTGCTCCTGAGCCAAGGTGAAA No data
Right 1081536740 11:44002179-44002201 TGGCCCCAGACCACCGGAAAGGG No data
1081536729_1081536734 6 Left 1081536729 11:44002130-44002152 CCTGCTCCTGAGCCAAGGTGAAA No data
Right 1081536734 11:44002159-44002181 CTCCTTCCTCCTGTGTTACGTGG No data
1081536729_1081536739 25 Left 1081536729 11:44002130-44002152 CCTGCTCCTGAGCCAAGGTGAAA No data
Right 1081536739 11:44002178-44002200 GTGGCCCCAGACCACCGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081536729 Original CRISPR TTTCACCTTGGCTCAGGAGC AGG (reversed) Intergenic